
Ez a gabion termék magasabb minőséget képvisel az átlagnál. Nem kínai termékről van szó.Az egész termék tűzhorganyozott. A vastagsága csak 20 cm , nem foglalja el a kis telek nagy részét. A kerítés önálló egységekből tevődik össze. Minden egység 250 cm hosszú tartozik hozzá 2 acél oszlop és 2 duplán merevített tűzhorganyozott oldalháló.Nem tartalmaz további bonyolult alkatrészeket. A kívánt hosszúságot több szekció összecsatolásával tudjuk elérni. A felépítése igen egyszerű. Nem szükséges ... további részletek >>

hozzá speciális tudás. A kerítést tetszés szerinti darabos anyagokkal lehet feltölteni ez a legtöbbször egyszerű ököl nagyságú zúzott követ jelent de lehet akár kuglira vágott fa,bontott tégla,tört tetőcserép,fenyőtoboz és sok minden más is. Valójában a kerítés önhordó ha nem tölti fel semmivel akkor is ellátja a kerítés szerepét . A hirdetésben a 143 cm magas egység árát adtam meg ami 128,2 euro AFA -val. Az egész árlistát e-mail ban tudom elküldeni. Kapcsolat magyarul Dunaszerdahely tel: 00421 905 302 256 e-mail: ramol@ramolstone.sk www.gabionkeritesek.eu www.ko-burkolat.eu

Feladva: 2018-07-08 10:06:26    

Címkék, kulcsszavak: gabion kerítéskerítések

Brand new never opened still under warranty Antminer S9 - 13.5TH - 14.5TH. including power supply. Specification details: Power Use (W): 0.098 J/GH 10% at the wall Hash Algorithm: SHA-256 Brand: ASIC Miner Processing Speed (GH/s):13.5TH/s Model: S9 Compatible Currency:Bitcoin Mining Hardware: ASIC Contact details : James Mcgraw Email address : m cgrawj12@yahoo.com
A hirdetés részletei >>

Feladva: 2018-07-04 06:29:14    

Címkék, kulcsszavak: Antminer

SZOLGÁLTATÁSOK TAKARÍTÁS TERÜLETKARBANTARTÁS, ALKALMI, FOLYAMATOS:  Épületek, lépcsőházak, intézmények, tárolók, padlások teljes körű takarítása.  Fűkaszálás egyszeri és folyamatos.  Sport és egyéb rendezvények utáni terem, illetve szabadtéri terület takarítása.  Járdák seprése.  Hó eltakarítás.  Festés utáni takarítás.  Kisebb bontási, eltakarítási munkák. GALAMBRIASZTÁS:  Tüskék  Galambriasztók (ultrahangos, ... további részletek >>

stb.)  Galambriasztó gél (új technológia) REFERENCIÁVAL TÉRKŐ TISZTÍTÁS:  Benzin és olajfoltok eltávolítása, a felület visszanyeri eredeti színét. IRODA TAKARÍTÁS:  Folyamatos  Alkalmi ABLAKTISZTÍTÁS: SPECIÁLIS TAKARÍTÁS:  Csőtörések utáni alagsor, egyéb épület, fertőtlenítés, fertőtlenítő meszelés. IPARI TAKARÍTÁS:  Folyamatos, időszakos, külső-belső takarítás, fűnyírás. FÖLDMUNKÁK:(Kézi, gépi)  Vízelvezető és csővezeték árkok ásása, visszabetonozása.  Föld és egyéb törmelék rakodása, eltávolítása.  Egyéb földmunkák. KERTÉSZETI MUNKÁK  Fűnyírás  Sövénynyírás  Kertgondozás, stb. CSATORNA TISZTÍTÁS: VESZÉLYES FA KIVÁGÁS: REFERENCIÁK: Kaposvári Együd Árpád Művelődési Központ (Agóra) Kaposvári CBA Üzletház Latinka Kulturális Központ MÁV Ingatlankezelő Kft. Kaposvári Vagyonkezelő Zrt. Resti Kereskedelmi Zrt. Nagykanizsa Stop Shop /Üveg előtetők tisztítása Debrecen Stop Shop /Üveg előtetők tisztítása Miskolc Stop Shop /Üveg előtetők tisztítása Társasházak Jugisdomus Kft. Mkb Bank Debrecen BOSCH Miskolc Galambriasztás Maschinenring Magyarország Kft Elérhetőségek: Tel: 0630/533-8731 e-mail:profitakaritas@citromail.hu

Feladva: 2018-06-04 20:59:13    

Címkék, kulcsszavak: takarításirodagalambgalambriasztástüskegél

A Saffort.hu egy specializálódott széfekkel foglalkozó kereskedelmi hálózat. A Saffort által értékesített összes széfet ellenőrizzük - csak azokat a széfeket értékesítjük, amelyek minőségében biztosak vagyunk.
A hirdetés részletei >>

Feladva: 2018-05-29 16:57:49    

Címkék, kulcsszavak: https://www.saffortszef.hu

SAFFORT - széfekre specializálódott webáruház. Az első széfet 1998-ban értékesítettük. Azóta több tízezer széf került értékesítésre 10 európai országban, beleértve az Egyesült Királyságot, Németországot, Franciaországot, Olaszországot, Spanyolországot, Lengyelországot, Csehországot, Szlovákiát, Litvániát és Lettországot. Célunk, hogy ügyfeleinknek egy helyen biztosítsuk a széfek legnagyobb valasztékát versenyképes árakon. Széf gyártók és beszállítók számára olyan platformot kínálunk, ahol ... további részletek >>

sikeresen értékesíthetik széfjüket. Itt megtalálhatja számos híres európai vagy más széfgyártók termékeit egy helyen. A Saffort mindenféle széfet értékesít: Páncélszekrények, Tűzálló, Fali és padlószéfeket, Fegyvertárolókat, Letéti és Hotel széfeket, valamint kiváló formatervezésű luxusszéfeket. A Saffortnál találhat széfet otthonok és irodák számára. A Saffort által értékesített összes terméket ellenőriztük - csak azokat a termékeket adjuk el, amelyek minőségében biztosak vagyunk, és amelyek számára kiváló szállítást és kiszolgálást biztosítunk. A vásárlási folyamatot egyszerűvé és kényelmesebbé tesszük.

Feladva: 2018-05-29 16:53:05    

Címkék, kulcsszavak: Széfek

NÉMET MUNKA – Sátorépítő német munkahely Nr. 154 Sátorépítő német munkahely Koblenz közelében Azonnali belépéssel keresünk 3-4 fő fizikai munkás férfit A2 némettudással 10€ bruttó fizetéssel, havi 160óra munkaidővel, ami ezen felül van az túlóraként ki lesz fizetve. Szállás 180€/hónap. A feladat Németország területén sör és egyéb rendezvény sátrak felépítése és később lebontása. Ez a munka október végéig tart, de következő évben tavasztól folytatódik. Jogosítvány előnyt ... további részletek >>

jelent, de nem kell a munkához. Szükséges a jó fizikai állapot, józan életmód és dolgozni akarás. 25-40 év közötti korú a csapat, ezért hasonló életkorúak jelentkezését várják. A munkáltató német cég egy 20-25 főt foglalkoztató, a sátorépítésre specializálódott vállalkozás. Folyamatosan frissített, naprakész AKTUÁLIS állásaink a weboldalunkon találhatóak: http://www.nemetmunka.hu/allasaink.html és http://www.nemetmunka.hu/vendeglatos-munka.html Minden állásunk betöltésével német nyelvű munkaszerződést kap a dolgozó, amely megértésében, átbeszélésében igény szerint szívesen segítünk. Hosszútávú munkát keresőkre számítunk. A munkaközvetítésért vagy egyéb másért fizetni, ill. bármit aláírni nem kell! Jelentkezni lehet (e-mailben, regisztrálással vagy telefonon): 1.) E-mailben: info@nemetmunka.hu (telefonszám megadásával) 2.) Ingyenes regisztrációval a következő linkre kattintva: http://www.nemetmunka.hu/regisztracio-nemetorszagi-munkavegzesre.html 3.) Telefonon hétfőtől-péntekig a magyar 06 1 920 3433, ill. a német 0049 8641 6949 000 vezetékes számokon (hétfőtől péntekig 9.00-15.00-ig). Josef Kling EXACT Personal UG 83224.Grassau (német munkaközvetítő cég Bajorországban) Cégjegyzék száma: HRB 25122 Traunstein (közvetítési vagy egyéb díj nincs) www.nemetmunka.hu

Feladva: 2018-05-23 14:03:31    

NÉMET MUNKA – Sátorépítő német munkahely Nr. 154 Sátorépítő német munkahely Koblenz közelében Azonnali belépéssel keresünk 3-4 fő fizikai munkás férfit A2 némettudással 10€ bruttó fizetéssel, havi 160óra munkaidővel, ami ezen felül van az túlóraként ki lesz fizetve. Szállás 180€/hónap. A feladat Németország területén sör és egyéb rendezvény sátrak felépítése és később lebontása. Ez a munka október végéig tart, de következő évben tavasztól folytatódik. Jogosítvány előnyt ... további részletek >>

jelent, de nem kell a munkához. Szükséges a jó fizikai állapot, józan életmód és dolgozni akarás. 25-40 év közötti korú a csapat, ezért hasonló életkorúak jelentkezését várják. A munkáltató német cég egy 20-25 főt foglalkoztató, a sátorépítésre specializálódott vállalkozás. Folyamatosan frissített, naprakész AKTUÁLIS állásaink a weboldalunkon találhatóak: http://www.nemetmunka.hu/allasaink.html és http://www.nemetmunka.hu/vendeglatos-munka.html Minden állásunk betöltésével német nyelvű munkaszerződést kap a dolgozó, amely megértésében, átbeszélésében igény szerint szívesen segítünk. Hosszútávú munkát keresőkre számítunk. A munkaközvetítésért vagy egyéb másért fizetni, ill. bármit aláírni nem kell! Jelentkezni lehet (e-mailben, regisztrálással vagy telefonon): 1.) E-mailben: info@nemetmunka.hu (telefonszám megadásával) 2.) Ingyenes regisztrációval a következő linkre kattintva: http://www.nemetmunka.hu/regisztracio-nemetorszagi-munkavegzesre.html 3.) Telefonon hétfőtől-péntekig a magyar 06 1 920 3433, ill. a német 0049 8641 6949 000 vezetékes számokon (hétfőtől péntekig 9.00-15.00-ig). Josef Kling EXACT Personal UG 83224.Grassau (német munkaközvetítő cég Bajorországban) Cégjegyzék száma: HRB 25122 Traunstein (közvetítési vagy egyéb díj nincs) www.nemetmunka.hu

Feladva: 2018-05-23 13:22:34    

Címkék, kulcsszavak: NÉMET MUNKASÁTOR

Működő Kéményjavítási Megoldások a Kéményjavítási specialistától. - Kéményajtó Beépítés - Légbevezető beszerelése ablakba - Füstcső (összekötőelem) csere - Kéménybélelés Hans Péter Kéményjavítási Specialista +3670 4240 292 www.KemenyJAVITAS.hu
A hirdetés részletei >>

Feladva: 2018-05-17 17:30:43    

Címkék, kulcsszavak: Kéményajtókéményajtó beépítéslégbevezetőlégbevezető beszerelésefüstcsőfüstcső cserekéménybélelés

Fa és műanyag nyílászáróknál, speciális szigeteléssel, egyszeri végleges megoldással.
A hirdetés részletei >>

Feladva: 2018-05-10 15:37:22    

NÉMET MUNKA -3 férfi fémipari állás- Nr. 129 Géplakatos, gépszerelő német állás -Villingen Új kollégát keresünk azonnali belépéssel gépszerelő, géplakatos , gépésztechnikus, stb végzettséggel 16-22€ bruttó órabérért, (2800-3960€ bruttó havi bér) heti 45 órás munkahéttel. Karácsonyi pénz és 27 nap éves szabadság van. A szállás megoldott, 300€ / hónap. A munkáltató egy több mint 20 éve működő használt földmunka gépeket felújító, bérbeadó és forgalmazó cég. Nr. 128 ... további részletek >>

Lakatos német állás Pforzheim közelében 1978 óta működő, több mint 100 főt foglalkoztató, gépek fém vázának gyártására specializálódott fémipari cég részére keresünk legalább A2 némettudással azonnali belépéssel lakatos szakmunkást 13€ bruttó kezdő órabértől. (2080€ bruttó) 40 órás munkahét van, túlóra lehetőséggel. A túlórák, éjszakai, hévégi és ünnepi munkákra külön pótlékot fizet a cég. Szállás megoldott 200-300€-ért. Nr. 49 Csőszigetelő német állás Németországban Németországban Bamberg és Bayreuth közötti településen lévő közepes méretű (30-25 fős) csőszigetelő német cég keres 2-3 új csőszigetelő dolgozót. Ez egy egy olyan német munkahely ahol évek óta dolgozik 2-3 magyar csőszigetelő munkás, ezért ez a német állás azon kevés kivételhez tartozik, (nálunk) ahol elegendő minimális némettudás.(A1) Szállás a munkásszállón ingyenes, ha vidéken kell dolgozni, akkor fizetik a szállást és a 24€ nettó napidíjat is. A csőszigetelő kezdő fizetése bruttó 11,30-€-tól egyéni megegyezés szerint. Folyamatosan frissített, naprakész AKTUÁLIS állásaink a weboldalunkon találhatóak: http://www.nemetmunka.hu/allasaink.html és http://www.nemetmunka.hu/vendeglatos-munka.html Minden állásunk betöltésével német nyelvű munkaszerződést kap a dolgozó, amely megértésében, átbeszélésében igény szerint szívesen segítünk. Hosszútávú munkát keresőkre számítunk. A munkaközvetítésért vagy egyéb másért fizetni, ill. bármit aláírni nem kell! Jelentkezni lehet (e-mailben, regisztrálással vagy telefonon): 1.) E-mailben: info@nemetmunka.hu (telefonszám megadásával) 2.) Ingyenes regisztrációval a következő linkre kattintva: http://www.nemetmunka.hu/regisztracio-nemetorszagi-munkavegzesre.html 3.) Telefonon munkaidőben a magyar 06 1 920 3433, ill. a német 0049 8641 6949 000 vezetékes számokon (hétfőtől péntekig 9.00-17.00-ig). Josef Kling EXACT Personal UG 83224.Grassau (német munkaközvetítő cég Bajorországban) Cégjegyzék száma: HRB 25122 Traunstein (közvetítési vagy egyéb díj nincs) www.nemetmunka.hu

Feladva: 2018-05-03 14:01:14    

Címkék, kulcsszavak: géplakatoslakatoscsőszerelőnémetmunkanémetmunkahely

NÉMET MUNKA- Építőipari állások, burkoló, tetőfedő, ács, kőfaragó Nr.130 Kőfaragó, kőmegmunkáló német állás Passau Azonnali belépéssel keresünk Baustelle némettudással kőfaragót, kő megmunkálót, gránithoz és márványhoz értő szakembert. A kezdő fizetés 11,50-12,50€ bruttó fizetéssel, 40 órás munkahéttel. Túlóra van, amit kifizetnek. Szállás ingyenesen megoldott. A német munkáltató egy több mint 50 éve működő cég. Márvány, gránit és egyéb kövek megmunkálására vannak specializálódva. ... további részletek >>

Nr.131 Tetőfedő vagy ács német munkahely Ulm -nál Azonnali belépéssel német munkahely 2 fő tetőfedő vagy ács részére. A fizetés 14-15€ órabér, 42 órás munkahét. Szállás 250€-ért van. A német munkáltató egy kis sváb családi vállalkozás, amelyet 2 testvér közösen csinál. Az új tetőfedő vagy ács kollégára a cég növekedése miatt van szükség. Olyan faipari szakembert, ácsot vagy tetőfedőt keresnek aki hosszútávú németországi munkahelyet keres és legalább Baustelle németet beszél, de jobb, ha A2 némettudással rendelkezik. Nr.48 Németországi hidegburkolói állás Mannheim - Heidelberg - Landau- alvállalkozóként is Azonnali belépéssel 4-5 fő hidegburkolót keresünk 14€ bruttó kezdő órabérrel, (2520€ bruttó) ami 19€ bruttó (3420€ bruttó) órabérig emelkedhet. A munkaidő heti 45 óra. A szállás megoldott. Németországi szerződött hidegburkoló szakmunkásokat foglalkoztató német partnerünk részére keresünk szakképzett hidegburkoló, önállóan hidegburkoló munkásokat és cégeket. A hidegburkoló munka bejelentett német állás, német munkahely formájában tölthető be. Vagy hidegburkoló cég jelentkezése esetén a hidegburkoló cég alvállalkozóként is szóba jöhet a szerződéskötés direkt a német hidegburkoló céggel. További naprakész AKTUÁLIS állásaink a weboldalunkon vannak: http://www.nemetmunka.hu/allasaink.html és http://www.nemetmunka.hu/vendeglatos-munka.html Minden munkánknál német nyelvű munkaszerződés van, aminek átbeszélésében szívesen segítünk annak, aki kéri. Hosszútávú munkát keresők jelentkezését várjuk. A munkaközvetítésért vagy bármiért fizetni, vagy bármit aláírni nem kell. Jelentkezni lehet: (e-mailben, regisztrálással vagy telefonon) 1.) E-mailben: info@nemetmunka.hu (telefonszám megadásával) 2.) Ingyenes regisztrációval a következő linkre kattintva: http://www.nemetmunka.hu/regisztracio-nemetorszagi-munkaveg…; 3.) Telefonon munkaidőben a magyar 06 1 920 3433 ill. a német 0049 8641 6949 000 vezetékes számokon. (hétfőtől péntekig 9.00-17.00-ig) Josef Kling EXACT Personal UG 83224.Grassau (német munkaközvetítő cég Bajorországban) Cégjegyzék száma: HRB 25122 Traunstein (közvetítési vagy egyéb díj nincs) www.nemetmunka.hu

Feladva: 2018-04-26 13:15:26    

Címkék, kulcsszavak: Német munkaÉpítőipari állásokburkolótetőfedőácskőfaragó

Hat az egyben készülék = ebook + audio + kép + internet + rádio + szótár 6 E-Ink kijelző WiFi adapter, beépített mikrofon és sztereó hangszóró Kb. 15 000 oldalnyi olvasást lehetővé tevő akkukapacitás QWERTY billentyűzet 10.3mm vastagság 2GB memória, G-szenzor A Prestigio Libretto ebook szériája még új a termékek között, de egyben a leginnovatívabb is. Az Ön egész könyvtára a zsebében elérhető bárhol, bármikor, amikor Ön akarja, non-stop, 24/7. Pihenjen és olvassa a kedvenc könyveit, ... további részletek >>

hallgassa a kedvenc zenéit közben. A továbbfejlesztett energiagazdálkodásnak köszönhetően extra hosszú a beépített akkumulátor üzemideje. Használja a strandon, vagy az ágyban, tömegközlekedési eszközön, ez a könnyű, kézreálló ebook készülék egyet jelent a 21. század olvasási szokásaival. Specifikációk: ebook formátumok: PDF & Epub (with Adobe DRM),FB2, CHM, Mobi, TXT, RTF, HTM, HTML, PDB, Djvu, DJV, DOC, XLS, PPT, ZIP and RAR Audio formátumok: WMA, OGG, WAV Kép formátumok: JPG, BMP, GIF, PNG, TIFF Méret: 192×125×10.3mm Tömeg: 300 g Kijelző méret: 6” (15.3 cm) Felbontás: 800×600 pixel Kijelző technológia: energiatakarékos E-Ink, 16 szürkeárnyalatos Billentyűzet: fizikai QWERTY Szenzor: G-szenzor (elfordulás-érzékelő) Vezeték nélküli kapcsolat: WiFi Tápellátás: beépített Lithium-Polymer akkumulátor 1.300 mAh Üzemidő: ~ 15.000 oldal olvasása Operációs rendszer: Linux alapú Processzor: Samsung S3C2416 ARM 9 400MHz Memória: 128 MB RAM / 128 MB ROM Memória bővítés: microsd max 32 GB-ig (2 GB-os microsd tartozék) Csatlakozás: USB (microusb) és 3.5 mm-es sztereó fülhallgató jack

Feladva: 2018-04-08 18:58:33    

Cégünk, az Infinity ArchMedia rendezvényfotózásra és rendezvényvideózásra specializálódott vállalkozás. Vállaljuk üzleti események, rendezvények,konferenciák fotózását és videózását, image filmek készítését. Az Infinity ArchMedia ezen felül vállalja épületek kültéri fotózását, valamint enteriőr fotózást és ipari fotózást is. Szolgáltatásaink nem csak Budapesten, hanem az ország teljes területén elérhetők.
A hirdetés részletei >>

Feladva: 2018-03-13 12:39:41    

Címkék, kulcsszavak: épületfotózásenteriőr fotózásingatlanfotózásrendezvényfotózáskonferenciafotózásüzleti fotózásüzleti portréipari fotózásrendezvényvideóreklámfilm

Programot keress, vagy kínál? Koncertek, könyvbemutatók, filmbemutatók, kiállításmegnyitók, ismeretterjesztő előadások, klubfoglalkozások, zene, tánc, színház és sok minden más. Lehet, hogy épp a közeledben. Szervezők és eladók linkajánlójával és bemutatkozásával. Kategória:Szórakozás - Programok
A hirdetés részletei >>

Feladva: 2018-02-14 16:32:16    

Címkék, kulcsszavak: programokrendszvényekprogramajánlóspeciális linktár

Hat az egyben készülék = ebook + audio + kép + internet + rádio + szótár 6 E-Ink kijelző WiFi adapter, beépített mikrofon és sztereó hangszóró Kb. 15 000 oldalnyi olvasást lehetővé tevő akkukapacitás QWERTY billentyűzet 10.3mm vastagság 2GB memória, G-szenzor A Prestigio Libretto ebook szériája még új a termékek között, de egyben a leginnovatívabb is. Az Ön egész könyvtára a zsebében elérhető bárhol, bármikor, amikor Ön akarja, non-stop, 24/7. Pihenjen és olvassa a kedvenc könyveit, ... további részletek >>

hallgassa a kedvenc zenéit közben. A továbbfejlesztett energiagazdálkodásnak köszönhetően extra hosszú a beépített akkumulátor üzemideje. Használja a strandon, vagy az ágyban, tömegközlekedési eszközön, ez a könnyű, kézreálló ebook készülék egyet jelent a 21. század olvasási szokásaival. Specifikációk: ebook formátumok: PDF & Epub (with Adobe DRM),FB2, CHM, Mobi, TXT, RTF, HTM, HTML, PDB, Djvu, DJV, DOC, XLS, PPT, ZIP and RAR Audio formátumok: WMA, OGG, WAV Kép formátumok: JPG, BMP, GIF, PNG, TIFF Méret: 192×125×10.3mm Tömeg: 300 g Kijelző méret: 6” (15.3 cm) Felbontás: 800×600 pixel Kijelző technológia: energiatakarékos E-Ink, 16 szürkeárnyalatos Billentyűzet: fizikai QWERTY Szenzor: G-szenzor (elfordulás-érzékelő) Vezeték nélküli kapcsolat: WiFi Tápellátás: beépített Lithium-Polymer akkumulátor 1.300 mAh Üzemidő: ~ 15.000 oldal olvasása Operációs rendszer: Linux alapú Processzor: Samsung S3C2416 ARM 9 400MHz Memória: 128 MB RAM / 128 MB ROM Memória bővítés: microsd max 32 GB-ig (2 GB-os microsd tartozék) Csatlakozás: USB (microusb) és 3.5 mm-es sztereó fülhallgató jack

Feladva: 2018-02-11 11:03:59    

Ingyen hírdethet a Nemzeti Apró-ban! Meghirdetheti keresletét, kínálatát, szolgáltatását és még sok minden mást. Jelenleg 28 kategória áll rendelkezésére hirdetése megfelelő elhelyezéséhez, olyanok is amelyek lehet, hogy az Ön hírdetéséhez a legideálisabb, és nincs mindenhol. Nálunk talál rendezvényekhez, vagy közérdekű és egyéb speciális igényehez is kategóriát és menüpontokat ahova egyedi portékája bekerülhet. A rendezvény témakörben feladatott hirdetése a Magyar Rendezvények ... további részletek >>

(http://www.magyarrendezvények.com) programajánlójába is felkerülhet! Kiemelt helyeket vásárolhat vagy időszakosan licitálhat is bizonyos helyeken való megjelenésre!

Feladva: 2018-02-09 20:16:52    

Címkék, kulcsszavak: NemzetiApróNemzeti apróhírdetésekrendezvenyekhova menjünk?

NEHÉZ, TÚLSÚLYOS, MÉRETES TÁRGYAK, ESZKÖZÖK SPECIÁLIS MOZGATÁSA, SZÁLLÍTÁSA Cégünk tapasztalt emberei vállalják a nehéz tárgyak, berendezések, eszközök (gépek hűtők, klímák, jakuzik, zongorák, pianínók, egyéb nehéz hangszerek, stb.) szakszerű mozgatását, szállítását.
A hirdetés részletei >>

Feladva: 2018-01-24 09:12:01    

Címkék, kulcsszavak: költöztetésköltöztetés Budapestnehéz tárgyak szállításalomtalanítás

Eladó egy új építésű 172 m2-es műhely, ipari társasházban Nagytarcsán, az M0-ás autóút közelében, 2017 április végi átadással. A képek a korábbi 17 db elkészült és értékesített épületben készültek.Az eddig átadott fejlesztésekben 165 egység lett kialakítva, 113 vállalkozás számára. A berendezés opcionálisan kérhető, nem része az alapárnak. A leválasztott önálló albetét, üzemi és raktározási célokra egyaránt alkalmas. Teljes közművel és mérőórákkal ellátott ipari ingatlanhoz, 12.07 méter hosszú ... további részletek >>

parkolására alkalmas homlokzat tartozik. Az ingatlan 14,25 x 12,07 méteres alapterületű galériázható, széles ipari kapuval és személyi bejáróval felszerelt. Kamionnal az egész épület körbejárható. Korszerű szendvicspanel csarnok „A” energiatanúsítvánnyal rendelkezik! Belmagasság 5,3 – 7,7 m között. Területen bármely termelő, kereskedelmi és szolgáltató tevékenység végezhető (kivétel néhány nagyon zavaró speciális tevékenység). Ár: 20,47 Millió Ft.+ ÁFA. Kifejezetten ipari ingatlanokkal foglalkozunk. Eladó/kiadó raktárakat , telkeket, telephelyeket talál honlapunkon. www.raktarbank.hu

Feladva: 2018-01-12 14:33:37    

Címkék, kulcsszavak: eladó raktár Nagytarcsa

Vedd ki a részed a kriptovaluta piacból és tegyél szert könnyedén te is bitcoinra. Két lehetőséget ajánlok: 1. Hashflare: Egy sima bitcoin, ethereum felhő bányász cég, ahol a napi bányászati részesedésed mellett 10% ajánlói jutalékban is részesülsz, ha ajánlod a céget. Regisztráció: https://hashflare.io/r/28D920B1 2. Invia World: A kriptovaluta bányászat mellett komoly hálózatépítői jövedelmet is szerezhetsz az alattad felépülő hálózatból. Speciális, egyedi szoftverük segítségével ... további részletek >>

mindig a legkifizetődőbb kriptovalutát bányásszák! Napi bányászati jövedelem bitcoinban, hálózati jutalékok euróban! Ingyenes regisztráció: https://inviaworld.com/preregister/11539 Csomag vásárlás: https://inviaworld.com/miner/11539 Magyar nyelvű infók: http://info.kmdholding.com/t/f/79/48 Mindkét cég aktuális eredményeit itt olvashatod: http://blog.1000000.hu

Feladva: 2018-01-07 12:38:51    

Labdien Kas specializējas finansējuma, investīciju a kredītu jomā starp indivīdiem, és a visiem indivīdiem morāle a īpaši spēj pildīt savas saistības. Esmu Runa ar Sadas jomas: Kredits: darbinieki, celtniecības egy renovācijas, kereskedelmi, diákok, Auto Citi / dažādi, uzņēmējdarbības, Lauksaimniecības, informācijas tehnoloģiju, īpašuma Intelektuālā, pakalpojumu, ... további részletek >>

rūpniecības, mākslinieki módok sabiedrība Medicinas, plašsaziņas līdzekļiem, Hipoteku, nekustamo ipasumu . A jebkura cita informācija, nevilcinieties, lai mani pa e-pastu tikai pie kontaktpersonas: IVANA.FINANCIE1@OUTLOOK.COM

Feladva: 2017-12-07 19:10:14    

Címkék, kulcsszavak: 1230

Üdvözöllek! „TheNewHope2x3com” Az elsők között értesítelek, hogy eljött a te időd! Milliomosok születnek, és TE vagy a következő! Sorsdöntő lehetőség. Egy kiugrási esély NEKED! Egyszeri 0.007 Btc- és a Bónusz 7 Btc-t újra és újra! Kidolgozott speciális csapat építő technikák! Mi a speciálist is kicsit megfűszereztük. Kőbe vésett Marketing, 100% kifizetési garancia! Regisztráció: https://www.thenewhope2x3.com/spla sh3.php?r=greskogy2 Várom jelentkezésed.
A hirdetés részletei >>

Feladva: 2017-11-25 17:08:16    

Zárnyitás, ajtónyitás teljesen roncsolás mentesen manipulációs zárnyitás technikával. Több mint 20 év zárnyitás területén szerzett szakmai tapasztalatunk alapján, nem csak a becsapódott ajtókat tudjuk roncsolás mentsen kinyitni, hanem azokat is, amelyek kulcsra vannak zárva. Speciális német és amerikai szerszámok segítségével a manipulációs zárnyitás, azaz a finomnyitás technikát alkalmazva a kéttollas (Mottura, Cisa, CR, S.A.B. Viro, Dierre Atra stb) és cilinderes zárak belső záró elemeit addig ... további részletek >>

mozgatjuk, amíg mindegyik a megfelelő pozícióba kerül, és úgy kinyílik a zárszerkezet mintha a saját kulcsát használtuk volna. Ebből következően a zárnyitás során semmiképpen nem tud megsérülni sem az ajtó sem pedig a zárszerkezetek, így továbbra is tudja azokat használni zárcsere nélkül is.

Feladva: 2017-11-24 00:12:40    

Címkék, kulcsszavak: zárnyitásajtónyitászárcserezárszerelészárnyitás Budapestajtónyitás Budapestmanipulációs zárnyitásTrezorzár nyitásszéfnyitásszéfjavításroncsolás mentes zárnyitás

Zárnyitás, ajtónyitás teljesen roncsolás mentesen manipulációs zárnyitás technikával. Több mint 20 év zárnyitás területén szerzett szakmai tapasztalatunk alapján, nem csak a becsapódott ajtókat tudjuk roncsolás mentsen kinyitni, hanem azokat is, amelyek kulcsra vannak zárva. Speciális német és amerikai szerszámok segítségével a manipulációs zárnyitás, azaz a finomnyitás technikát alkalmazva a kéttollas (Mottura, Cisa, CR, S.A.B. Viro, Dierre Atra stb) és cilinderes zárak belső záró elemeit addig ... további részletek >>

mozgatjuk, amíg mindegyik a megfelelő pozícióba kerül, és úgy kinyílik a zárszerkezet mintha a saját kulcsát használtuk volna. Ebből következően a zárnyitás során semmiképpen nem tud megsérülni sem az ajtó sem pedig a zárszerkezetek, így továbbra is tudja azokat használni zárcsere nélkül is.

Feladva: 2017-11-23 23:55:49    

Címkék, kulcsszavak: zárnyitásajtónyitászárcserezárszerelészárnyitás Budapestajtónyitás Budapestmanipulációs zárnyitásTrezorzár nyitásszéfnyitásszéfjavításroncsolás mentes zárnyitás

Zárnyitás, ajtónyitás teljesen roncsolás mentesen manipulációs zárnyitás technikával. Több mint 20 év zárnyitás területén szerzett szakmai tapasztalatunk alapján, nem csak a becsapódott ajtókat tudjuk roncsolás mentsen kinyitni, hanem azokat is, amelyek kulcsra vannak zárva. Speciális német és amerikai szerszámok segítségével a manipulációs zárnyitás, azaz a finomnyitás technikát alkalmazva a kéttollas (Mottura, Cisa, CR, S.A.B. Viro, Dierre Atra stb) és cilinderes zárak belső záró elemeit addig ... további részletek >>

mozgatjuk, amíg mindegyik a megfelelő pozícióba kerül, és úgy kinyílik a zárszerkezet mintha a saját kulcsát használtuk volna. Ebből következően a zárnyitás során semmiképpen nem tud megsérülni sem az ajtó sem pedig a zárszerkezetek, így továbbra is tudja azokat használni zárcsere nélkül is.

Feladva: 2017-11-23 21:40:25    

Címkék, kulcsszavak: zárnyitásajtónyitászárcserezárszerelészárnyitás Budapestajtónyitás Budapestmanipulációs zárnyitásTrezorzár nyitásszéfnyitásszéfjavításroncsolás mentes zárnyitás

Üdvözöllek! „TheNewHope2x3com” Az elsők között értesítelek, hogy eljött a te időd! Milliomosok születnek, és TE vagy a következő! Sorsdöntő lehetőség. Egy kiugrási esély NEKED! Egyszeri 0.007 Btc- és a Bónusz 7 Btc-t újra és újra! Kidolgozott speciális csapat építő technikák! Mi a speciálist is kicsit megfűszereztük. Kőbe vésett Marketing, 100% kifizetési garancia! Regisztráció: https://www.thenewhope2x3.com/spla sh3.php?r=greskogy2 Várom jelentkezésed.
A hirdetés részletei >>

Feladva: 2017-11-22 19:20:53    

Üdvözöllek! „TheNewHope2x3com” Az elsők között értesítelek, hogy eljött a te időd! Milliomosok születnek, és TE vagy a következő! Sorsdöntő lehetőség. Egy kiugrási esély NEKED! Egyszeri 0.007 Btc- és a Bónusz 7 Btc-t újra és újra! Kidolgozott speciális csapat építő technikák! Mi a speciálist is kicsit megfűszereztük. Kőbe vésett Marketing, 100% kifizetési garancia! Regisztráció: https://www.thenewhope2x3.com/spla sh3.php?r=greskogy2 Várom jelentkezésed.
A hirdetés részletei >>

Feladva: 2017-11-22 19:18:34    

Üdvözöllek! „TheNewHope2x3com” Az elsők között értesítelek, hogy eljött a te időd! Milliomosok születnek, és TE vagy a következő! Sorsdöntő lehetőség. Egy kiugrási esély NEKED! Egyszeri 0.007 Btc- és a Bónusz 7 Btc-t újra és újra! Kidolgozott speciális csapat építő technikák! Mi a speciálist is kicsit megfűszereztük. Kőbe vésett Marketing, 100% kifizetési garancia! Regisztráció: https://www.thenewhope2x3.com/spla sh3.php?r=greskogy2 Várom jelentkezésed.
A hirdetés részletei >>

Feladva: 2017-11-22 19:15:53    

Anselmo Pebble Art Unique personalised pebble pictures, seaglass pictures, framed pictures and slate hearts from South Devon, UK. www.anselmopebbleart.co.uk Buy your special Christmas present now.
A hirdetés részletei >>

Feladva: 2017-11-03 23:55:49    

Címkék, kulcsszavak: pebble artseaglass pictureChristmas gift

Ajándékozz egészséget Karácsonyra! Mindenkinek jól jön egy kis egészség! A ganoderma gyógygomba termékek speciális csomagjaival megajándékozhatod a családod, plusz visszakapod a teljes vásárlás árát +10 %-ot. A részleteket telefonon vagy e-mailben megbeszéljük, hívj, segítek! http://ganodermashop.hu/ Csontos Zsuzsa 06 70 2085088 cson tz@gmail.com
A hirdetés részletei >>

Feladva: 2017-10-29 17:50:29    

Címkék, kulcsszavak: gyógygombakarácsonyi akcióingyen ajándék

Új hálózat, speciális magyar pénzkeresési lehetőség. Mem MLM, nem ptc, hanem pénzkeresés reklámok megtekintésével. Ajándékokat kaphatsz a reklámok megtekintéséért. Nem igényel befektetést, nincsenek benne gyanús, átverés jellegű dolgok.
A hirdetés részletei >>

Feladva: 2017-10-25 07:58:36    

Cégünk tapasztalt emberei vállalják a nehéz tárgyak, berendezések, eszközök (gépek hűtők, klímák, jakuzik, zongorák, pianínók, egyéb nehéz hangszerek, stb.) szakszerű mozgatását, szállítását. Raktárainkban lehetőséget biztosítunk ügyfeleinknek, akár azonnal bútorok, eszközök, egyéb ingóságok rövidebb-hosszabb idejű elhelyezésére.
A hirdetés részletei >>

Feladva: 2017-10-10 11:46:09    

Címkék, kulcsszavak: gépszállításnehéz gép szállításspeciális tárgy

Cégünk tapasztalt emberei vállalják a nehéz tárgyak, berendezések, eszközök (gépek hűtők, klímák, jakuzik, zongorák, pianínók, egyéb nehéz hangszerek, stb.) szakszerű mozgatását, szállítását. Raktárainkban lehetőséget biztosítunk ügyfeleinknek, akár azonnal bútorok, eszközök, egyéb ingóságok rövidebb-hosszabb idejű elhelyezésére.
A hirdetés részletei >>

Feladva: 2017-10-03 11:30:30    

Címkék, kulcsszavak: költöztetésirodaköltöztetésszállításbútorszállítászongoraszállításlomtalanításnonstop költöztetés

Cégünk tapasztalt emberei vállalják a nehéz tárgyak, berendezések, eszközök (gépek hűtők, klímák, jakuzik, zongorák, pianínók, egyéb nehéz hangszerek, stb.) szakszerű mozgatását, szállítását. Raktárainkban lehetőséget biztosítunk ügyfeleinknek, akár azonnal bútorok, eszközök, egyéb ingóságok rövidebb-hosszabb idejű elhelyezésére.
A hirdetés részletei >>

Feladva: 2017-10-03 10:44:43    

Címkék, kulcsszavak: költözésBudapest költözésköltözés Budapestköltöztetésszállításbútorszállításlomtalanításgépszállítászongoraszállításnonstop költöztetésolcsó költöztetés

platós/ponyvás teherautó bérlés!!! 1990 évj.(90 km / óra az utazója- hosszú távra ne készülj vele) 9999 Ft/nap. IVECO teherautó: 5000ft-tól 3óra! Kaukció: 100 000 Ft 365nap, non-stop elérhetőség! – speciális árak hosszú távú bérlés esetén!
A hirdetés részletei >>

Feladva: 2017-09-18 11:38:44    

Címkék, kulcsszavak: teherkisteherbérlésfurgonkölcsönzőkölcsönzésbérbeadásbérautó

Megmentjük és olcsó csereautót is biztosítunk. Autómentés,furgon szállítás, daruzás patakból- árokból, daruzás, autószállítás non-stop. Budapest és Pest megye azonnal, vidéki autómentés esetén a lehető legrövidebb időn belüli elindulás. Autóparkunk és kollégáim segítségével megoldjuk az Önnök problémáját autószállítás: darus technikával (feltört, bezárt, erősen sérült, megszorult futóművű autók) munkagép mentés, daruzás, szállítás különleges, speciális, extrém szállítások.
A hirdetés részletei >>

Feladva: 2017-09-08 09:51:24    

platós ponyvás teherautó kölcsönözhető. 1990 évj.(90 km / óra az utazója- hosszú távra ne készülj vele) Iveco Platos-ponyvás 9990Ft/nap. IVECO teherautó: 5000ft-tól 3óra! Kaukció: 100 000 Ft 365nap, non-stop elérhetőség, autókiszállítás bármely megyébe (kiszállási díj előre utalással) - speciális árak hosszú távú bérlés esetén.A korlátlan kilométer használatot Magyarországon. A kötelező biztosítást. a gépkocsi külső-belső tisztítását (az autót tisztán adjuk át, és a bérlés után mi is ... további részletek >>

így várjuk vissza vagy 3000Ft-ért takarítjuk ki)

Feladva: 2017-07-26 15:04:49    

Szeretné, ha haja egészséges, csillogó és dús lenne? Szeretne kellemes környezetben, igazi szakemberek által gyógyulni, szépülni? Nem elégedett a boltokban kapható hajápoló termékekkel? Szalonunk a következő szolgáltatásokat ajánlja: -Hajgyógyászati kezelések: hajhullás, kopaszodás, korpa, zsírosodás, száraz, vékony, töredezett haj és fejbőr panaszok problémájára. Több mint 20 éves tapasztalattal! Személyre szabott kezelési programok, professzionális gyógyászati anyagok, komfortos érzés ... további részletek >>

kezelés közben! Mikrokamerás hajdiagnosztika, fejbőr és hajvizsgálat -Biofodrászat: Haj-állapotfelmérés speciális kamerával. Az Ön stílusának és hajszerkezetének legmegfelelőbb módszerekkel dolgozunk. Vegyszermentes hajfestés a haj szerkezetét erősítő festékkel, (maximális őszfedéssel) Természetes eredetű styling anyagok (hajhab, zselé, hajlakk), melyek meg is vásárolhatóak! Referenciaszalonunkban speciális, biológiailag aktív növényi hatóanyagokkal dolgozunk! Hajmosás, styling, vágás személyre szabottan, az ön haj-és fejbőrtípusának megfelelően. Ionos hajszárítás, kolloid ásványi anyagokkal történő hajfeltöltés. Vegyszermentes hajfestés, hajszerkezet-visszaépítés, vékonyszálú haj erősítése Egyedülálló, a hajszálak szerkezetébe beépülő biológiailag aktív növényi hatóanyagaink biztosítják, hogy az Ön frizurája nemcsak szép, hanem egészséges is legyen!

Feladva: 2017-06-26 10:09:20    

Címkék, kulcsszavak: hajgyógyászat

Szeretné, ha haja egészséges, csillogó és dús lenne? Szeretne kellemes környezetben, igazi szakemberek által gyógyulni, szépülni? Nem elégedett a boltokban kapható hajápoló termékekkel? Szalonunk a következő szolgáltatásokat ajánlja: -Hajgyógyászati kezelések: hajhullás, kopaszodás, korpa, zsírosodás, száraz, vékony, töredezett haj és fejbőr panaszok problémájára. Több mint 20 éves tapasztalattal! Személyre szabott kezelési programok, professzionális gyógyászati anyagok, komfortos érzés ... további részletek >>

kezelés közben! Mikrokamerás hajdiagnosztika, fejbőr és hajvizsgálat -Biofodrászat: Haj-állapotfelmérés speciális kamerával. Az Ön stílusának és hajszerkezetének legmegfelelőbb módszerekkel dolgozunk. Vegyszermentes hajfestés a haj szerkezetét erősítő festékkel, (maximális őszfedéssel) Természetes eredetű styling anyagok (hajhab, zselé, hajlakk), melyek meg is vásárolhatóak! Referenciaszalonunkban speciális, biológiailag aktív növényi hatóanyagokkal dolgozunk! Hajmosás, styling, vágás személyre szabottan, az ön haj-és fejbőrtípusának megfelelően. Ionos hajszárítás, kolloid ásványi anyagokkal történő hajfeltöltés. Vegyszermentes hajfestés, hajszerkezet-visszaépítés, vékonyszálú haj erősítése Egyedülálló, a hajszálak szerkezetébe beépülő biológiailag aktív növényi hatóanyagaink biztosítják, hogy az Ön frizurája nemcsak szép, hanem egészséges is legyen!

Feladva: 2017-06-26 10:09:15    

Címkék, kulcsszavak: hajgyógyászat

Szeretné, ha haja egészséges, csillogó és dús lenne? Szeretne kellemes környezetben, igazi szakemberek által gyógyulni, szépülni? Nem elégedett a boltokban kapható hajápoló termékekkel? Szalonunk a következő szolgáltatásokat ajánlja: -Hajgyógyászati kezelések: hajhullás, kopaszodás, korpa, zsírosodás, száraz, vékony, töredezett haj és fejbőr panaszok problémájára. Több mint 20 éves tapasztalattal! Személyre szabott kezelési programok, professzionális gyógyászati anyagok, komfortos érzés ... további részletek >>

kezelés közben! Mikrokamerás hajdiagnosztika, fejbőr és hajvizsgálat -Biofodrászat: Haj-állapotfelmérés speciális kamerával. Az Ön stílusának és hajszerkezetének legmegfelelőbb módszerekkel dolgozunk. Vegyszermentes hajfestés a haj szerkezetét erősítő festékkel, (maximális őszfedéssel) Természetes eredetű styling anyagok (hajhab, zselé, hajlakk), melyek meg is vásárolhatóak! Referenciaszalonunkban speciális, biológiailag aktív növényi hatóanyagokkal dolgozunk! Hajmosás, styling, vágás személyre szabottan, az ön haj-és fejbőrtípusának megfelelően. Ionos hajszárítás, kolloid ásványi anyagokkal történő hajfeltöltés. Vegyszermentes hajfestés, hajszerkezet-visszaépítés, vékonyszálú haj erősítése Egyedülálló, a hajszálak szerkezetébe beépülő biológiailag aktív növényi hatóanyagaink biztosítják, hogy az Ön frizurája nemcsak szép, hanem egészséges is legyen!

Feladva: 2017-06-26 10:09:10    

Címkék, kulcsszavak: hajgyógyászat

Szeretné, ha haja egészséges, csillogó és dús lenne? Szeretne kellemes környezetben, igazi szakemberek által gyógyulni, szépülni? Nem elégedett a boltokban kapható hajápoló termékekkel? Szalonunk a következő szolgáltatásokat ajánlja: -Hajgyógyászati kezelések: hajhullás, kopaszodás, korpa, zsírosodás, száraz, vékony, töredezett haj és fejbőr panaszok problémájára. Több mint 20 éves tapasztalattal! Személyre szabott kezelési programok, professzionális gyógyászati anyagok, komfortos érzés ... további részletek >>

kezelés közben! Mikrokamerás hajdiagnosztika, fejbőr és hajvizsgálat -Biofodrászat: Haj-állapotfelmérés speciális kamerával. Az Ön stílusának és hajszerkezetének legmegfelelőbb módszerekkel dolgozunk. Vegyszermentes hajfestés a haj szerkezetét erősítő festékkel, (maximális őszfedéssel) Természetes eredetű styling anyagok (hajhab, zselé, hajlakk), melyek meg is vásárolhatóak! Referenciaszalonunkban speciális, biológiailag aktív növényi hatóanyagokkal dolgozunk! Hajmosás, styling, vágás személyre szabottan, az ön haj-és fejbőrtípusának megfelelően. Ionos hajszárítás, kolloid ásványi anyagokkal történő hajfeltöltés. Vegyszermentes hajfestés, hajszerkezet-visszaépítés, vékonyszálú haj erősítése Egyedülálló, a hajszálak szerkezetébe beépülő biológiailag aktív növényi hatóanyagaink biztosítják, hogy az Ön frizurája nemcsak szép, hanem egészséges is legyen!

Feladva: 2017-06-26 10:09:04    

Címkék, kulcsszavak: hajgyógyászat

Szeretné, ha haja egészséges, csillogó és dús lenne? Szeretne kellemes környezetben, igazi szakemberek által gyógyulni, szépülni? Nem elégedett a boltokban kapható hajápoló termékekkel? Szalonunk a következő szolgáltatásokat ajánlja: -Hajgyógyászati kezelések: hajhullás, kopaszodás, korpa, zsírosodás, száraz, vékony, töredezett haj és fejbőr panaszok problémájára. Több mint 20 éves tapasztalattal! Személyre szabott kezelési programok, professzionális gyógyászati anyagok, komfortos érzés ... további részletek >>

kezelés közben! Mikrokamerás hajdiagnosztika, fejbőr és hajvizsgálat -Biofodrászat: Haj-állapotfelmérés speciális kamerával. Az Ön stílusának és hajszerkezetének legmegfelelőbb módszerekkel dolgozunk. Vegyszermentes hajfestés a haj szerkezetét erősítő festékkel, (maximális őszfedéssel) Természetes eredetű styling anyagok (hajhab, zselé, hajlakk), melyek meg is vásárolhatóak! Referenciaszalonunkban speciális, biológiailag aktív növényi hatóanyagokkal dolgozunk! Hajmosás, styling, vágás személyre szabottan, az ön haj-és fejbőrtípusának megfelelően. Ionos hajszárítás, kolloid ásványi anyagokkal történő hajfeltöltés. Vegyszermentes hajfestés, hajszerkezet-visszaépítés, vékonyszálú haj erősítése Egyedülálló, a hajszálak szerkezetébe beépülő biológiailag aktív növényi hatóanyagaink biztosítják, hogy az Ön frizurája nemcsak szép, hanem egészséges is legyen!

Feladva: 2017-06-26 10:08:59    

Címkék, kulcsszavak: hajgyógyászat

Ismerkedj biztonságosan személyiség központú társkeresőnkön rejtett költségek nélkül. Miért biztonságos a LoveBuzzler? Beépített funkcióinkkal lehetőséged van tiltani, jelenteni a zaklatókat, továbbá beállításainkban egyéb eszközök is rendelkezésedre állnak, hogy távol tartsd magadtól őket. Személyiség központú, ez mit jelent? Szakértőnkkel - Habis Melinda, klinikai szakpszichológus, pár-és családterapeuta jelölt, személyközpontú terapeuta- segítségével létrehoztunk egy speciális kérdőívet, ... további részletek >>

amely kitöltése során személyiségi diagramot rajzol programunk a legfontosabb emberi személyiségjegyekről pl. megbízhatóság. A kérdésekre adott válaszokat kiszemelted adatlapján megnézheted egyesével. Minden kérdésünk párkapcsolat alapjául szolgáló konfliktushelyzeteket térképezi fel. Ennek köszönhetően már az előtt tudod, miben különböztök, hasonlítotok, mielőtt még elmélyülne a kapcsolatotok. Valamint, azt is, hogy mint veszekednétek már a kezdetektől fogva, amik valószínűleg csak később derülne ki, így megóvhatod magad a csalódásoktól is. Továbbá önmagadat is jobban megismerheted! Szakértői segítség révén online felteheted kérdéseidet, amelyekre kiváló szakemberünk Habis Melinda és kollégái válaszolnak. Nem hagyunk magadra! Megéri kipróbálni! 3 napig minden új regisztrálónk használhatja a LoveBuzzler társkereső minden funkcióját, úgy mintha fizetős tagja lenne oldalunknak. Ha lejár a három nap akkor ugyanúgy ingyen használhatod tovább, csak korlátozottan, amelyet feloldhatsz havi fix. egyszeri tagsági díj megfizetése után. Nincsenek csomagjaink csak egyszeri díj, így mindenki egyenlő esélyek mellett ismerkedhet! https://lovebuzzler.com/

Feladva: 2017-06-24 16:25:52    

Címkék, kulcsszavak: ingyenes társkeresőbiztonságos társkeresőkomoly kapcsolatszemélyiség központú társkereső

Helló Én az egyén, aki kínál hiteleket a nemzetközi. A tőke fogják használni, hogy a hiteleket rövid és hosszú távú speciális 1000 € az 15,000, 000€ minden komoly emberek vannak valóságos szükségnek, a kamat 3% -át évente. azt nyújt pénzügyi hitel, lakáshitel, beruházási hitel, auto hitel, személyi kölcsön. Elérhető vagyok, hogy megfeleljen az ügyfelek legfeljebb két napon belül az alkalmazás. Senki nem komoly tartózkodik. E-mail: francesco.servillo@mail.ru köszönöm
A hirdetés részletei >>

Feladva: 2017-06-22 16:42:28    

Helló Van egy tőke, amelyeket használni fognak, hogy grant short és hosszú távú speciális kölcsönök kezdve € 5000 € 1.000.000 semmilyen komoly ember akar a kölcsönt. 3% -os kamatot évente szerinti összeget kölcsönzött, mert, hogy különösen nem akarom, hogy megsértik a törvény uzsora. Akkor visszafizetni több mint 3 és 25 év közötti maximális szerint a kölcsönadott összeget. ez rajtad múlik, hogy havi kifizetéseket. Kérem csak felismerése kézzel írt minősített adósság, és még néhány ... további részletek >>

alkatrész szükséges. Mert minden rászoruló forduljon e-mailt vagy Whatsapp: E-mail: jacquelinemartinezjacqueline@gmail.com E-mail: jacquelinemartinezjacqueline@gmail.com

Feladva: 2017-05-12 17:12:35    

Címkék, kulcsszavak: paris

Értékesítési asszisztenst munkatársat keresünk. Munkavégzés helye: Budapest Az Alphasonic Kft. 25 éve működő budapesti székhelyű nagykereskedés. Informatikai eszközök és biztonságtechnikai rendszerek forgalmazásával foglalkozunk. Olyan innovatív és speciális megoldásokat kínálunk partnereinknek, amelyekkel minden eddiginél költséghatékonyabban és környezetkímélőbben tudják megoldani a felmerülő problémáikat. Vásárlás előtt minden eszköz megtekinthető, és legtöbbjük ki is ... további részletek >>

próbálható, azért hogy az ügyfelek kifogástalan minőségű termékeket kapjanak, melyek valóban megfelelnek az igényeiknek. Jelenleg országszerte, mintegy 5000 viszonteladóból álló értékesítési hálózattal rendelkezünk és 25 éve stabilan haladunk előre. Elkötelezett értékesítési csapatunk célja, hogy a hozzánk segítségért forduló partnereinknek olyan megoldást kínáljunk, ami nem csak a jelenlegi, hanem az esetleges jövőbeli problémáktól is mentesíti őket. Ezért folyamatosan képezzük munkatársainkat, hogy naprakész szakmai tudásukkal képviselni tudják a céget, a termékeinket. Értékesítőként fő feladatod lesz a partnereid menedzselése, nyomon követése, hogy pontosan tudd, hogy személyre szabottan kinek mit kell ajánlanod. A kialakult ügyfélkör ápolása mellet új ügyfelek felkutatása is feladatod lesz. Ahhoz, hogy eredményes légy munkádban szükség lesz alapvető számítástechnikai ismeretekre, kitartásodra és tudásod folyamatos bővítésére. Jelentkezésedben mindenképpen tüntesd fel korábbi eredményeidet, melyek hozzájárultak sikereid eléréséhez. Jelentkezni az alábbi linken lehet: http://aruhaz.alphasonic.hu/allas-hALLAS.html

Feladva: 2017-05-10 14:44:10    

Európaszállító Nemzetközi költöztetés csomagszállítás,autószállítás, csomagküldés Uniós országokon belül bárhonnan-bárhová Az Európai Unión belül bármely országba Külföldre és Belföldre egyaránt ,3,5 t zárt dobozos,ponyvás kisteherautóinkkal. Több éves szakmai tapasztalatunknak köszönhetően költöztetésre specializálódott cégünknek sok olyan elégedett ügyféle van, akik csomagküldés; szállítás, költöztetés, fuvarozás kapcsán többször is visszatérnek hozzánk. Külföldi költöztetésnél is ... további részletek >>

természetesen garanciát vállalunk a szállítmány hibátlan átadására. Hívjon, minket akár ÉJJEL- NAPPAL bizalommal csatlakozzon elégedett ügyfeleink széles körébe.

Feladva: 2017-04-11 06:48:28    

Légy a munkatársam, "édes bűnbe" csábítalak ;) Szereted a csokit és szeretnél egészségesen élni és fogyni? Rengeteg lehetőség között választhatsz! Ismerd meg ezt a magyar céget, aki egy egyedülálló lehetőséget kínál számodra Csoki Egyetem Mivel speciális eljárással készült, egészséges összetevőkkel felturbózott prémium csokoládéról van szó, ezért sajnos valóban olyan az ár, ami nem mindenki számára megfizethető. Nagyon örülünk azonban, hogy ennek a promóciónak hála sokan úgy döntenek, hogy ... további részletek >>

kihasználják a 33%-os kedvezményt, és kipróbálják termékünket. Így 48 db 6 grammos csokoládé darabja 154 forint, ami szerintünk jó ajánlat https://youtu.be/vJw_F4hr7Yk https://prosperitygroup.co/pages/tamarin83

Feladva: 2017-04-07 12:41:57    

Címkék, kulcsszavak: stresszmenteshozambefektetésegészségképzés

Autóvillamossági szerelő Cégjellemzők: Gépjárműipari területen tevékenykedő kisvállalat autóvillamossági szerelőt keres. Termékeink saját tervezésű és gyártású teherautó felépítmények, kisbuszok, szervizautók, különleges járművek. A cég tevékenysége: • Autóbuszgyártás, • Gépjármű átalakítás, • Speciális járműfelépítmények gyártása. Feladatok • Korszerű autóbuszok szervizelése, • Autó hifi berendezések beépítése, szervizelése, • Hibakeresés, ... további részletek >>

hibakiolvasás, • Szakszerű karbantartási és javítási munkák végzése, • Dokumentálás, utómunkák elvégzése. • Nyitottság a változatos feladatokra. Elvárások • Autóvillamossági végzettség • B kategóriás jogosítvány • Több éves járműiparban szerzett tapasztalat. • Önállóan dolgozni tudó kollégákat keresünk. Munkavégzés helye: Budapest, 17. kerület, Szabadság utca 9-11. Jelentkezés módja: • E-mail: info@buszbox.hu • Személyesen, telefonos időpont- egyeztetés után. • Tel: 1/ 258-3585

Feladva: 2017-03-31 14:28:05    

Karosszéria lakatos Cégjellemzők: Gépjárműipari területen tevékenykedő kisvállalat karosszéria lakatost keres.Termékeink saját tervezésű és gyártású teherautó felépítmények, kisbuszok, szervizautók, különleges járművek. A cég tevékenysége: • Autóbuszgyártás, • Gépjármű átalakítás, • Speciális járműfelépítmények gyártása. Elvárások: Karosszéria lakatos szakvégzettség, Több éves járműiparban szerzett tapasztalat B kategóriás jogosítvány Feladatok: • ... további részletek >>

Gépjárművek vázszerkezetének, külső lemezborításának, szerelvényeinek elkészítése, szerelése, burkolása • Vas- és fémszerkezetek elemeinek előrajzolása, lemezek, idomprofilok darabolása, a darabolt anyagok összeillesztése, csavarozása, anyagok hajlítása, formálása, alakítása • Hegesztési műveletek végzése • Alkatrészek elkészítése, összeszerelése, föl- és leszerelése, karbantartása és javítása • Szakszerű karbantartási és javítási munkák végzése Munkavégzés helye: Budapest, 17. kerület, Szabadság utca 9-11. Jelentkezés módja: • E-mail: info@buszbox.hu • Személyesen, telefonos időpont- egyeztetés után. • Tel: 1/ 258-3585

Feladva: 2017-03-31 14:24:47    

DUGULÁSELHÁRÍTÁS ! Falbontás nélkül, fürdőszobai, konyhai lefolyok , csatornák takarítása. ÉJJEL-NAPPAL! Budapest, Gyál, Sülysáp, Uri, Maglód, Ecser, Pécel, Gyömrő, Isaszeg, Gödöllő, Monor, Monorierdő, Pilis, Mende, Nagykáta, Tápióság, Nyáregyháza. . . . . Pest megye 06 70 502 5620 Duguláselhárítás speciális gépekkel, bontás nélkül. Kiszállás 2 órán belül. 06 70 502 5620
A hirdetés részletei >>

Feladva: 2017-02-22 12:47:07    

Címkék, kulcsszavak: DuguláselhárításJavításTakarításSzerelésTisztításMosogatóPest megyeLefolyóWcKézmosóZsírtalanításGyökértelenítésEldugultPadlóösszefolyó.StrangRossz Lefol

A ULTRAVOICE DIGITAL VX2496 egy kiváló minőségű mikrofon előerősítő / hangprocesszor alapuló VX2000. A VX2496 tartalmaz egy AES / EBU kimenet (digitális kimenet 24 bit / 96 kHz), beleértve opto kompresszor, dinamikus enhancer, expander, de-Esser és cső szimuláció. Ha egy felvétel zenész, home / project stúdió tulajdonosa, illetve a munka elsősorban a digitális tartományban, és rögzíteni kell ének egy digitális rendszer, ez a gép. Főbb jellemzői közé tartozik a 24-bit / 96 kHz-es AES / EBU ... további részletek >>

kimenet állítható mintavétel vagy külső órajelet. Van egy diszkrét ULN mikrofon / vonal bemenet színpadon puha néma 48 V fantomtáppal. Hiteles cső emuláció áramkör biztosít tipikus cső és a szalag telítettség hangokat, és van egy valódi RMS bővítő egyenletes zajcsökkentést. Opto kompresszor biztosítja hallható dinamikus szabályozás és kreatív jelfeldolgozó lehetőségeket. Egy hang optimalizált hangszínszabályzó speciálisan a hang javítása. Jellemzők: Ultra alacsony zajszintű diszkrét vintage-design mikrofon / vonal bemeneti fokozat 24 bites AES / EBU kimenet válaszható 44,1, 48, 88,2 és 96 kHz mintavételi frekvencia vagy külső órajel Univerzális minta arány szinkronizálást wordclock vagy digitális bemenet Hiteles cső emuláció áramköröket tipikus cső és szalag telítettség hangok True RMS bővítő rendkívül sima zajcsökkentés Opto kompresszor hallható szintszabályozás és kreatív hangfeldolgozó Integrált dinamikus enhancer helyettesíti a magas frekvenciák elveszett a tömörítés Hang-optimalizált hangszínszabályzó kifejezetten hang javítása Opto de-Esser gyors eltávolítására túlzott sziszegést saját vokális track Nagy teljesítményű VCA rendkívül természetes hangfeldolgozó Ultra alacsony zajszintű 4580 műveleti erősítők kiemelkedő audio teljesítményt Pontos LED mérés kristálytiszta szint és a processzor jelzést Servo-egyensúlyban aranyozott XLR csatlakozók, minden főbb be- és kimenetek Ultra nagy pontosságú ALPS potenciométer végső pontosság és ismételhetőség Világító kapcsolók biztosítják a tökéletes működést sötét színpadi környezetben Kiváló minőségű alkatrészek és rendkívül robusztus konstrukció a hosszú élettartam és a tartósság Árnyékolt toroid transzformátor legalacsonyabb interferencia Terveztek és a BEHRINGER Németország

Feladva: 2017-02-19 08:43:41    

Címkék, kulcsszavak: Ultravoicemikrofon előerősítőhangprocesszor

A ULTRAVOICE DIGITAL VX2496 egy kiváló minőségű mikrofon előerősítő / hangprocesszor alapuló VX2000. A VX2496 tartalmaz egy AES / EBU kimenet (digitális kimenet 24 bit / 96 kHz), beleértve opto kompresszor, dinamikus enhancer, expander, de-Esser és cső szimuláció. Ha egy felvétel zenész, home / project stúdió tulajdonosa, illetve a munka elsősorban a digitális tartományban, és rögzíteni kell ének egy digitális rendszer, ez a gép. Főbb jellemzői közé tartozik a 24-bit / 96 kHz-es AES / EBU ... további részletek >>

kimenet állítható mintavétel vagy külső órajelet. Van egy diszkrét ULN mikrofon / vonal bemenet színpadon puha néma 48 V fantomtáppal. Hiteles cső emuláció áramkör biztosít tipikus cső és a szalag telítettség hangokat, és van egy valódi RMS bővítő egyenletes zajcsökkentést. Opto kompresszor biztosítja hallható dinamikus szabályozás és kreatív jelfeldolgozó lehetőségeket. Egy hang optimalizált hangszínszabályzó speciálisan a hang javítása. Jellemzők: Ultra alacsony zajszintű diszkrét vintage-design mikrofon / vonal bemeneti fokozat 24 bites AES / EBU kimenet válaszható 44,1, 48, 88,2 és 96 kHz mintavételi frekvencia vagy külső órajel Univerzális minta arány szinkronizálást wordclock vagy digitális bemenet Hiteles cső emuláció áramköröket tipikus cső és szalag telítettség hangok True RMS bővítő rendkívül sima zajcsökkentés Opto kompresszor hallható szintszabályozás és kreatív hangfeldolgozó Integrált dinamikus enhancer helyettesíti a magas frekvenciák elveszett a tömörítés Hang-optimalizált hangszínszabályzó kifejezetten hang javítása Opto de-Esser gyors eltávolítására túlzott sziszegést saját vokális track Nagy teljesítményű VCA rendkívül természetes hangfeldolgozó Ultra alacsony zajszintű 4580 műveleti erősítők kiemelkedő audio teljesítményt Pontos LED mérés kristálytiszta szint és a processzor jelzést Servo-egyensúlyban aranyozott XLR csatlakozók, minden főbb be- és kimenetek Ultra nagy pontosságú ALPS potenciométer végső pontosság és ismételhetőség Világító kapcsolók biztosítják a tökéletes működést sötét színpadi környezetben Kiváló minőségű alkatrészek és rendkívül robusztus konstrukció a hosszú élettartam és a tartósság Árnyékolt toroid transzformátor legalacsonyabb interferencia Terveztek és a BEHRINGER Németország

Feladva: 2017-02-12 08:14:14    

Kerékpár összeszerelői (betanulható) és raktárkezelői munkakörbe keresünk kollégákat. Munkaidő: Teljes munkaidő (Napi 8 órában) Munkavégzés helye: Szigetszentmiklós Feladatkör: - Speciális tervezésű biciklik összeszerelése - Beérkező nyersanyagok és kimenő rendelések pontos számszerűsítésében és betárolásában való részvétel - Raktár kezelése, megrendelések összekészítése festésre - Kiszállítás előkészítése,megrendelések komissiózása - Leltározásban való aktív részvétel ... további részletek >>

Elvárások: Szerelésben való jártasság Jó problémamegoldó képesség Rugalmasság, terhelhetőség Előny: Kerékpár összeszerelés területen szerzett tapasztalat Fényképes önéletrajzokat az anibel@ubw.hu-ra várjuk, fizetési igény megjelölésével!

Feladva: 2017-02-07 21:56:41    

Adóbevallás, könyvelés, gazdasági szakmai szakértés, adóoptimalizálás, költséggazdálkodás, pályázatírás,üzletviteli tanácsadás, komplex irodai szolgáltatás távmunkában is. Nagyobb volumenű vagy speciális megrendelések esetén jutalékot fizetek.
A hirdetés részletei >>

Feladva: 2017-02-06 13:53:41    

Címkék, kulcsszavak: könyvelésszámlairodatanácsadásadóellenőrzésgazdaságszakértésköltség.

10 fokozatu masszás öv eladó CSEPELEN 10.000FT 06203645194------------------fenékr e is lehet. masszázsövvel megerőltetés nélkül bírhatja munkára izmait. A speciális, két motoros oszcilláló masszázstechnika összehúzódásra és elernyedésre készteti az izmokat, a thermo masszázs pedig segíti a lerakódott zsírszövetek mobilizálását, így az öv rendszeres használata hatékony segítséget nyújthat a fogyásban és testsúlycsökkentésben is!
A hirdetés részletei >>

Feladva: 2017-02-06 13:47:41    

A Prezidium hevederzár egy-, kétszárnyú valamint garázsajtóra bármilyen ajtóvastagság és falkialakítás esetén jól felszerelhető. Alapfelszereltségben Titan k1-es típusú fúrásvédett betétet tartalmaz, de kívánság szerint más márkájú betéttel is szerelhető. A cilinderbetétet speciális felfogatása miatt törés és maghúzás ellen is védett.
A hirdetés részletei >>

Feladva: 2017-01-31 18:51:41    

Bérelhető autószállító trélerek, 5-8 méter hosszban 2,1 m széles 3000-3500 kg össztömegűek, hasznos terhelhetőségük 2450-2580 kg. 1-2 személyautó vagy egy furgon szállítására is biztonsággal alkalmasak. Nagy húzóerejű kézi csörlővel szerve. Kitűnő, új állapotú, rendszeresen karbantartott állapotban. Igény esetén specifikus kerékrögzítő spanifer szettel is bérelhető. Bérleti díj: 10.000,-Ft/nap tól. Igény esetén Belföldi és Nemzetközi autószállítást, 2500 kg és 8 m-ig vállalunk. (0-24) +36 ... további részletek >>

30/ 928 2002 www.axoler.hu (Autószállító Tréler, Autószállító utánfutó, Autószállítás, Autómentés, Express Fuvarozás, Direkt Transport)

Feladva: 2017-01-17 09:37:06    

Címkék, kulcsszavak: (Autószállító TrélerAutószállító utánfutóAutószállításAutómentésExpress FuvarozásDirekt Transport)

Helló Hölgyem / Uram! Keres egy kölcsön , akkor elutasította a bank , és azt szeretnénk, hogy egy kölcsön , hogy megfeleljen az Ön igényeinek nincs semmilyen probléma . Bármi legyen is a pénzügyi helyzete . Ajánlok jelzálog , kereskedelmi hitelek , a nemzetközi hitelek, személyi kölcsönök és hitelek kizárólag oktatási hitelek. Felajánlom hitelekhez partnerségek , más állami és magán , és még sokan mások . Én áll, hogy segítsen . Az ajánlatom tól 5000 € 30.000.000 € időszak 1 ... további részletek >>

és 30 év , a kamat 2%-os speciális kulcs ezért kérjük, lépjen kapcsolatba velem e-mail címre : . ( jacques6beseme@gmail.com ) további információkért az ajánlatomat . KÖSZÖNET

Feladva: 2016-12-06 13:39:09    

Címkék, kulcsszavak: HITEL

Helló Hölgyem / Uram! Keres egy kölcsön , akkor elutasította a bank , és azt szeretnénk, hogy egy kölcsön , hogy megfeleljen az Ön igényeinek nincs semmilyen probléma . Bármi legyen is a pénzügyi helyzete . Ajánlok jelzálog , kereskedelmi hitelek , a nemzetközi hitelek, személyi kölcsönök és hitelek kizárólag oktatási hitelek. Felajánlom hitelekhez partnerségek , más állami és magán , és még sokan mások . Én áll, hogy segítsen . Az ajánlatom tól 5000 € 30.000.000 € időszak 1 és 30 ... további részletek >>

év , a kamat 2%-os speciális kulcs ezért kérjük, lépjen kapcsolatba velem e-mail címre : . ( jacques6beseme@gmail.com ) további információkért az ajánlatomat . KÖSZÖNET

Feladva: 2016-12-06 13:38:06    

sziasztok! A nevem Nemeth Gabor Magyarorszagon szulettem 1976 08 15 Magyar Angol Swed Norveg Thai nyelvismerettel szeretnek munkat talalni szalassal Nemetorszagban. Az altalanos iskola utan hentesnek tanultam de nem fejeztem be mert forro veru fiatal voltam azaz egy huje nem gondolva arra hogy a jovoben jolenne ha lenne szakkepzettsegem!!!ma mar tudom! 29 evessen mentem ki swedorszagba dolgozni lakni,munkaim, hotelben takarito etkezes keszito agyazao ,aztan gyari munkas femekkel valo ... további részletek >>

savazas marattatas csiszolas forma kiontes specialis vegyvedelmi ruhaban.aztan allvanyozo gipszkartonozo festo profi automoso,magtanultam a swednyelvet az angolt norvegot mivel swed norveg majdnem ugyanaz.Jelenleg Thailandon elek eggy hotelben es masszorkent dolgozom, de dolgoztam soforkent negyevig,perszi jogsim sosem volt,tudom,neha kicsit kell fullenteni ahoz hogy az ember job munkat talaljon,mindenesetre most semmien fullentesrol nincs szo!!! A lenyeg hogy szeretnek Nemtorszagban elni es dolgozni szalassal,aztan termeszetessen kis ido multaval ha mar dolgozom sajat lakast berelni. Annyi penzem van hogy tudjak repulni esetleg ha lenne munka lehetoseg,negyven eves nem iszom dohanyzom szeredtem a kavet szeretek dolgozni minden eggyes munkam soran ugyes hamar tanulekony vagyok baratsagos!!! szeretnem elore is megkoszonni az esejt.....koszonom szepen

Feladva: 2016-11-02 08:20:56    

Címkék, kulcsszavak: tanulekony ugyes baratsagos

online vállalkozáshoz. Ha szeretnél eladni valamit meghirdeted egy apróhirdető oldalon, minél több oldalon adod fel annál nagyobb az esélyed hogy eladd amit hirdetsz. Célom egy egyedi és hatékony apróhirdető oldal hálózat létrehozása. A hirdetők és partnereink, különleges máshol nem elérhető lehetőséget kapnak. Egyszerű gyors hirdetésfeladás, hatékony megjelenés, bevételi és reklámlehetőség partnereink részére. Az oldalon történt hirdetés feladásával sok időt és pénzt, takaríthat ... további részletek >>

meg. Gyors kampányszerű megjelenés. Ami minden hirdetés lelke. Ez nem csupán egy weboldal, egy olyan speciális hirdető rendszer ami apróhirdető oldalakat fog hálózatba. Egyedi ajánlatom van azok részére akiknek fontos a gyors és sok, hirdetési felületen való megjelenés. Pl. INGATLANIRODA. Személyes tájékoztatás Budapesten. Minden megoldás érdekel. Szükséges tőke 3 M. Ft. Futamidő 18 hónap (lehet hogy rövidebb) 30% hozam. fbreklam@indamail.hu

Feladva: 2016-10-24 17:11:29    

Címkék, kulcsszavak: Üzleti angyaltbefektetőt keresek

online vállalkozáshoz. Ha szeretnél eladni valamit meghirdeted egy apróhirdető oldalon, minél több oldalon adod fel annál nagyobb az esélyed hogy eladd amit hirdetsz. Célom egy egyedi és hatékony apróhirdető oldal hálózat létrehozása. A hirdetők és partnereink, különleges máshol nem elérhető lehetőséget kapnak. Egyszerű gyors hirdetésfeladás, hatékony megjelenés, bevételi és reklámlehetőség partnereink részére. Az oldalon történt hirdetés feladásával sok időt és pénzt, takaríthat ... további részletek >>

meg. Gyors kampányszerű megjelenés. Ami minden hirdetés lelke. Ez nem csupán egy weboldal, egy olyan speciális hirdető rendszer ami apróhirdető oldalakat fog hálózatba. Egyedi ajánlatom van azok részére akiknek fontos a gyors és sok, hirdetési felületen való megjelenés. Pl. INGATLANIRODA. Személyes tájékoztatás Budapesten. Minden megoldás érdekel. Szükséges tőke 3 M. Ft. Futamidő 18 hónap (lehet hogy rövidebb) 30% hozam. fbreklam@indamail.hu

Feladva: 2016-10-24 16:03:55    

Címkék, kulcsszavak: Üzleti angyaltbefektetőt keresek

A készülék alkalmas az akupunktúrás pontokon végezhető mérésre,továbbá kvadráns mérésre és egy speciális elektródával az amalgám fogtömések állapotának felmérésére.A készülék USB porton keresztül számítógéphez csatlakoztatható. Telepítő lemez, mely windows7 programon futtatható. A számítógépen futó EAV Windows program számos funkcióval segíti a mérés elvégzését. Ajándék: dr. Rideg Sándor: Voll-féle Elektroakupunktúra Kézikönyv Árban megegyezünk
A hirdetés részletei >>

Feladva: 2016-10-17 10:13:46    

Alan speciális mentőként dolgozik, amíg egy nap egy bányaszerencsétlenségnél elveszti a látását. Úgy érzi, kicsúszik lába alól a talaj. Már-már teljesen belesüllyed az önsajnálatba, amikor összeismerkedik egy fiatal tanárnővel, aki képes őt pocsék állapotából kirángatni. A nőnek sem könnyű, hiszen ő meg egy autóbalesetben sérült meg. Kapcsolatuk hát nem mindennapi, de újabb fordulat történik: találnak egy donort, így a férfi visszanyeri látását. Vajon kapcsolatuk az újabb fordulat ellenére ... további részletek >>

megmarad olyannak, mint a kezdetekkor? http://adamobooks.com/termek-Vakon-szeretni-87.html

Feladva: 2016-09-30 15:34:29    

Üzleti terv (tervezet) Tisztelt Leendő Befektető! Speciális szakmával (Öntőmérnök) 56 évesen szinte lehetetlen elhelyezkednem! Ezért merült fel bennem az a gondolat,hogy magánemberként próbálom kialakítani egzisztenciámat! Sajnálatos módon sem ingatlanom sem pénzem nincs ezért keresek olyan befektetőt aki realitást lát kitűzött céljaim elérésében! A fő tevékenységet az alábbiak szerint foglalom össze: Indulásként –megalapozni a jövőt – a tőzsdei tevékenységet tűztem ... további részletek >>

ki célul! Ezt követően tanult szakmáimat is felvenném a tevékenységi körömbe! Az induláshoz szükséges összeg:1.300.000 mFt: Helységbérlet, iroda+lakás(kaució+ 3 havi részlet) 400.000 Ft Hardver 200.000 Ft Egyéb ktg 300.000 Ft Betét 400.000 Ft Összesen 1.300.000 Ft A bevételt 50 USD/nap nagyságrendben állapítottam meg. Ez havi 420.000 ft bevételt jelent! A befektetést 15% kamattal számolva havi 15% törlesztéssel a megtérülés 20 hónap! Köszönöm, hogy elolvasta tervemet, várom szíves visszajelzését: Tisztelettel Szűcs Béla

Feladva: 2016-09-25 09:36:38    

Adatrögzítést, könyvelés előkészítést is vállalok! Bármilyen, számítógépes adatrögzítést vállalok! Rendszergazdai szintet közelítő számítógépes tudással, Macintosh, és Windows, gépeim vannak, fotó, és szövegfeldolgozás, speciális programokkal is rendelkezek! Itthon is dolgozok, saját eszközökkel, naponta hozom, viszem az anyagot, bármilyen adathordozón! Fotózás, (NIKON D300), retus, szerkesztés, (kép, szöveg) analitika, (ÁFA, anyag, bármi!) Mások számítógépén is vállalok munkát! ... további részletek >>

(Karbantartás, gyorsítás, programok telepítése, archiválás, adatmentés, rendszer telepítés, töredezettség mentesítés, weboldal karbantartás, feltöltés, (fotók készítésével is!) szövegírás...) Sok féle számítógépes munkát elvégzek felelősséggel! (ADÓ, bevallások, banki terminál kezelése, átutalások...) Sürgős munkát reggelre, soron kívül is! Van bejelentett állásom, nem feltétlenül arra pályázok! Egyértelmű ajánlatot kérek, melyben a feladat, és az ellentételezés is látható, legalább fő vonalakban! Teljesítménnyel arányos jövedelemnek örülnék, jutalékos ”állás” NEM érdekel! Megadott névre, telefonszámra, a kért időpontban, jelentkezek! Köszönöm! iroda.raktar.bp@gmail.com

Feladva: 2016-09-21 09:58:22    

Címkék, kulcsszavak: adatrögzítésfotószövegfeldolgozásfotózásszámítógépes rendszergazdai feladatokadó tanácsadásadó optimalizálás

Sasadi úton lévő 50%.ban osztatlan közös tulajdonom értékesítésére,speciális befektetőt keresek. Aki tisztába van az osztatlan közös tulajdon minden lehetőségével. Megosztási vázrajz nincs! A villa 1930 években épült felújításra szorul, vagy akár luxus társasház is hamar lehet belőle. Az 50%.hoz két szint használata és 200nm2 lakrész és 300nm2 kertrészem van. Komoly tudású befektetőket keresünk! Irány ár: 60000000Ft Érdeklődni: 06309739822 06303386062
A hirdetés részletei >>

Feladva: 2016-09-02 22:34:13    

Címkék, kulcsszavak: eladoluxuswagner villasasadi útXI kerületvillafelujitandócsaládi házerkélybudapest1930

Magyarországon egyedülálló környezetvédelmi megoldás értékesítéséhez keresek munkatársat.Magas szintű képzés valamint jövedelem.Keresem azt aki jól kommunikál,értékesítési gyakorlattal rendelkezik,önálló munkavégzésre képes,szeret új dolgokban elsőként részt venni.
A hirdetés részletei >>

Feladva: 2016-06-20 15:21:40    

Magyarországon egyedülálló környezetvédelmi megoldás értékesítéséhez keresek munkatársat.Magas szintű kiképzés valamint jövedelem.Keresem azt aki jól kommunikál,értékesítési gyakorlattal rendelkezik,önálló munkavégzésre képes,szeret új dolgokban elsőként részt venni.
A hirdetés részletei >>

Feladva: 2016-06-15 08:28:14    

Magyarországon egyedülálló környezetvédelmi megoldás értékesítéséhez keresek munkatársat.Magas szintű kiképzés valamint jövedelem.Keresem azt aki jól kommunikál,értékesítési gyakorlattal rendelkezik,önálló munkavégzésre képes,szeret új dolgokban elsőként részt venni.
A hirdetés részletei >>

Feladva: 2016-06-15 08:25:46    

Autóhorpadás és jégkár javítás fényezés nélkül Szerző: autodivus 2016.06.06. h., 14.11 Oszd meg másokkal! Facebook Twitter Email Jég okozta sérülését vagy horpadását az autóján egy speciális eljárásnak köszönhetően fényezés nélkül meg tudjuk javítani. Így megspórolhatja a fényezés árát. Igény esetén csereautót tudunk biztosítani a javítás idejére. Folyamatos akciókkal és nagy kedvezményekkel várjuk jelenlegi és leendő ügyfeleinket!
A hirdetés részletei >>

Feladva: 2016-06-06 15:50:21    

Címkék, kulcsszavak: jégkárhorpadáslégkár javítás fényezés nélkülhorpadás javítás fényezés nélkül

Csokoládés Chocolate Slim! Természetes ital a fogyáshoz Segít gyorsan megszabadulni a túlsúlytól Küzd a narancsbőr ellen Eltávolítja a pattanásokat és kiütéseket Speciális ajánlat! 50%-os kedvezmény!
A hirdetés részletei >>

Feladva: 2016-06-02 10:32:51    

A Jégkár Horpadásjavító Kft. a járműveken – jégeső, vihar, parkolási vagy egyéb behatás miatt – keletkezett horpadások fényezésnélküli eltávolításának specialistája. E különleges technológia alkalmazásával nincs szükség a karosszéria sérült elemeinek cseréjére és újrafényezésére! Cégünk a telephelyen végzett javításokon túl mobil- szolgáltató is, így egész Európában neves autókereskedők, biztosítók, kölcsönzők és egyéb nagy személygépjármű-flottával rendelkezők tartanak igényt tevé
A hirdetés részletei >>

Feladva: 2016-05-11 19:13:24    

Feladatok: - Mintagyártások megtervezése, kivitelezése - Új technológiát meghatározó gépek, berendezések, programok, specifikálása, beüzemelése stb. Elvárások: - Felsőfokú műszaki végzettség (gépész- villamos- vegyész, ill. egyéb mérnök) - Műszaki ismeretek (műszaki rajzok értelmezése, jelölések, mérőeszközök ismerete, gyakorlati alkalmazásuk) - Tömeggyártásban, ill. autóiparban szerzett min. 3 éves szakmai tapasztalat - Krimpelésben szerzett gyakorlat - Kommunikációs szintű német/angol
A hirdetés részletei >>

Feladva: 2016-03-18 09:20:14    

Címkék, kulcsszavak: Krimpelési specialista mérnökKrimpelésispecialistamérnökkrimpelés

Feladatok: - Mintagyártások megtervezése, kivitelezése - Új technológiát meghatározó gépek, berendezések, programok, szerszámok specifikálása, beüzemelése stb. Elvárások: - Felsőfokú műszaki végzettség (gépész- villamos- vegyész, ill. egyéb mérnök) - Műszaki ismeretek (műszaki rajzok értelmezése, jelölések, mérőeszközök ismerete, gyakorlatban való alkalmazásuk) - Tömeggyártásban, ill. autóiparban szerzett min. 3 éves szakmai tapasztalat - Krimpelésben szerzett gyakorlat - Kommunikációs ... további részletek >>

szintű német/angol

Feladva: 2016-03-18 09:08:51    

Címkék, kulcsszavak: Krimpelési specialista mérnökKrimpelésispecialistamérnökkrimpelés

Feladatok: - Mintagyártások megtervezése és kivitelezése - Új technológiát meghatározó gépek, berendezések, programok, specifikálása, beüzemelése Elvárások: - Felsőfokú műszaki végzettség (gépész- villamos- vegyész, ill. egyéb mérnök) - Műszaki ismeretek (műszaki rajzok értelmezése, jelölések, mérőeszközök ismerete, gyakorlati alkalmazásuk) - Tömeggyártásban, ill. autóiparban szerzett min. 3 éves szakmai tapasztalat - Krimpelésben szerzett gyakorlat - Kommunikációs szintű német/angol
A hirdetés részletei >>

Feladva: 2016-03-17 16:51:07    

Címkék, kulcsszavak: Krimpelési specialista mérnökKrimpelésispecialistamérnökkrimpelés

Elvárások: - Felsőfokú műszaki végzettség (gépész- villamos- vegyész, ill. egyéb mérnök) - Műszaki ismeretek (műszaki rajzok értelmezése, jelölések, mérőeszközök ismerete, gyakorlatban való alkalmazásuk) - Tömeggyártásban, ill. autóiparban szerzett min. 3 éves szakmai tapasztalat - Kameraellenőrzési területen szerzett gyakorlat - Kommunikációs szintű német/angol Feladatok: - Mintagyártások megtervezése, kivitelezése - Új technológiát meghatározó gépek, programok specifikálása, beüzemelés
A hirdetés részletei >>

Feladva: 2016-03-17 11:58:09    

Címkék, kulcsszavak: Kameraellenőrzési specialista mérnökkameraellenőrzésmérnökKameraellenőrzésispecialista

Feladatok: - Mintagyártások megtervezése és kivitelezése - Új technológiát meghatározó gépek, programok specifikálása, beüzemelése Elvárások: - Felsőfokú műszaki végzettség (gépész- villamos- vegyész, ill. egyéb mérnök) - Műszaki ismeretek (műszaki rajzok értelmezése, jelölések, mérőeszközök ismerete, gyakorlatban való alkalmazásuk) - Tömeggyártásban, ill. autóiparban szerzett min. 3 éves szakmai tapasztalat - Kábelvágási területen szerzett gyakorlat - Kommunikációs szintű német/angol ny
A hirdetés részletei >>

Feladva: 2016-03-17 10:55:52    

Címkék, kulcsszavak: kábelvágáskábelvágásispecialistamérnöktömeggyártásautóipar

Lomtalanítás Budapesten, és vidéken, telefonos egyeztetés alapján is. Lakások, házak, irodák, műhelyek lomtalanítását is vállaljuk, munkatársaink segítenek dobozolni, felrakodni plusz költségek nélkül az ön által megtartani kívánt tárgyakat. Bútor és egyéb ingóságok szállítása, akár speciális feltételek mellett, a törékeny holmikat biztonságosan csomagoljuk. Költöztetéskor szükség esetén segítünk a dobozolásnál, rakodásnál külön költségek nélkül.
A hirdetés részletei >>

Feladva: 2016-03-12 06:56:09    

Helló Hölgyem / Uram! Van egy tőkét , hogy használják a hosszú távú speciális 1000€ 5.000.000€ , hogy mindenki komolyan veszi a kölcsönt. A 3%-os évi szerint mennyiség kerül felszámolásra főleg azért, mert nem akarom , hogy megszegjék a törvényt ellen uzsora . Fizethet 1-20 év , attól függően, hogy a kölcsön összegét . Attól függ, hogy a havi kifizetéseket. keresés "Csak segíteni az embereknek az egész sorozat . e-mail : roberta16cavilotti2016@gmail.com PS : Az emberek nem ... további részletek >>

tudott segíteni , mert nem akarok időt pazarolni a felesleges munka

Feladva: 2016-03-09 23:16:41    

Lomtalanítás Budapesten, és vidéken, telefonos egyeztetés alapján is. Lakások, házak, irodák, műhelyek lomtalanítását is vállaljuk, munkatársaink segítenek dobozolni, felrakodni plusz költségek nélkül az ön által megtartani kívánt tárgyakat. Bútor és egyéb ingóságok szállítása, akár speciális feltételek mellett, a törékeny holmikat biztonságosan csomagoljuk. Költöztetéskor szükség esetén segítünk a dobozolásnál, rakodásnál külön költségek nélkül.
A hirdetés részletei >>

Feladva: 2016-03-05 21:35:09    

Hitel tanú közötti ésszerű becsületes különösen Hi minden kedves barát Szeretnénk megosztani örömünket. Mi nagyon bosszantott az elmúlt hónapokban a házunk mi majdnem elveszett, mert a kölcsön bankunk a ráta nagyon nehéz elviselni. Egy barátom az én férj ajánlott minket egyik munkatársa, aki specializálódott hitelezési és finanszírozási kérdéseket. Nagyon gyors ez segített nekünk, ha egy gyors kölcsön 3 napig így tiszteljük tartozások oldalán a bank, és adott nekünk egy nagyon ésszerű ... további részletek >>

időben visszafizetni. Soha nem volt ilyen fajta szerencse az életünkben, és mi nem az egyetlen, élvezni, mert tudjuk, hogy sok másokkal, ahogy szeretnénk élni ezt a kölcsönt anélkül, hogy a bankok, hogy ők könyörtelenül. Ez a lehetőség azt is lehetővé tette számunkra, hogy csináld nyilvánosság akkor lépjen közvetlenül: celineduboi01@gmail.com kész kielégíteni azoknak az ügyfeleknek 72 órán belül kézhezvételét kérelmét. E-mail: celineduboi01@gmail.com

Feladva: 2016-02-26 22:41:22    

Professzionális gépparkunkkal várjuk póló nyomtatás, pólónyomás iránt érdeklődő partnereink érdeklődését. Kiemelt ügyfélkezelés, gyors, pontos, garantált minőségű munka. Széles szín- és fazon választék a hagyományos kereknyakútól a „slim fit” és V nyakú pólókig, a speciális, légáteresztő anyagú technikai pólóktól a strapabíró munkaruházatig (női, gyermek és unisex fazonban egyaránt). Részletes információkért keresse weboldalunkat ! Ha póló nyomtatás: http://polokeszites.hupont.hu
A hirdetés részletei >>

Feladva: 2016-02-26 13:08:57    

Címkék, kulcsszavak: pólónyomáspóló nyomtatás

Autóipari beszállító vállalat csapatába keresünk: Automatizálás technológia specialista mérnököt Elvárások: - Felsőfokú műszaki végzettség (gépész- villamos- vegyész, illetve egyéb mérnök) - Műszaki ismeretek (műszaki rajzok értelmezése, jelölések, mérőeszközök ismerete és gyakorlatban való alkalmazásuk) - Tömeggyártásban, ill. autóiparban szerzett min. 3 éves tapasztalat - Automatizálási területen szerzett gyakorlat - Kommunikációs szintű német és/vagy angol nyelvtudás szóban és ... további részletek >>

írásban egyaránt - Megbízható, hatékony munkavégzés - Motivált, önálló, felixibilis személyiség Előny: - Problémamegoldó és analitikus gondolkodás Amit kínálunk: - Folyamatos fejlődési és előrelépési lehetőség - Stabil multinacionális háttér, hosszú távú munkalehetőség - Dinamikus, jó csapat, összetartó kollégák - Modern technológia és munkakörnyezet Munkavégzés helye: Jászárokszállás (Hatvan, Gyöngyös, Jászberény térsége) Jelentkezés: Amennyiben hirdetésünk felkeltette érdeklődését, kérjük, önéletrajzát „Automatizálás technológia specialista mérnök” jelige feltüntetésével juttassa el az allas06@blnhc.hu e-mail címre. További információ: +36-30/412-7265

Feladva: 2016-02-25 10:38:04    

Cégünk szerelt homlokzat burkolàsi munkákra specializálódott ( természetes kövek, kerámia, trespa, fundermax, kerlit, eternit, stb ), Az ország egész területén,illetve külföldön is.Amennyiben sikerült felkeltenem az érdeklődését, kérem vegye fel velünk a kapcsolatot. Egy jövőbeli közös munka reményében .Tisztelettel Lukàcs Róbert
A hirdetés részletei >>

Feladva: 2016-02-22 19:36:12    

Cégünk szerelt homlokzat burkolàsi munkákra specializálódott ( természetes kövek, kerámia, trespa, fundermax, kerlit, eternit, stb ), Az ország egész területén,illetve külföldön is.Amennyiben sikerült felkeltenem az érdeklődését, kérem vegye fel velünk a kapcsolatot. Egy jövőbeli közös munka reményében .Tisztelettel Lukàcs Róbert
A hirdetés részletei >>

Feladva: 2016-02-22 19:30:47    

Cégünk elsősorban kötéltechnika (alpintechnika) alkalmazásával építőipari szakmunkákat végez ott, ahol az állványozás nem lehetséges, költséges vagy időigényes lenne. Szolgáltatásaink: üvegfal, ablak tisztítása homlokzatfelújítási munkák fémkémények bontása és építése gallyazás veszélyelhárítás szigetelés kéményjavítás tetőfedői munkák galambmentesítés ereszcsatorna tisztítása, javítása viharkárok helyreállítása kőműves munkák ... további részletek >>

egyéb speciális feladatok

Feladva: 2016-02-16 19:00:15    

Címkék, kulcsszavak: alpintechnikaalpinistahomlokzat felújításbádogozásüvegfelület tisztításgalambmentesítésfakivágástetőjavítás

Hi minden kedves barát Szeretnénk megosztani örömünket. Mi nagyon bosszantott az elmúlt hónapokban a házunk majdnem elveszett, mert a nyújtott kölcsön bankunk által a ráta nagyon nehéz elviselni. Egy barátja a férjem ajánlott minket egyik munkatársa, aki specializálódott hitel problémák és finanszírozás. Nagyon gyors ez segített nekünk, ha egy gyors kölcsön 3 napig így tiszteljük adósságok a bank felé, és megadta nekünk időtartamra teljesen ésszerű visszafizetni. Soha nem volt az a fajta ... további részletek >>

szerencse az életünkben, és mi nem az egyetlen, élvezni, mert tudom, hogy sok más ember, mint ahogy azt igénybe ezt a hitelt, anélkül, hogy a bankok, azok könyörtelen. ezt a lehetőséget mi lehetővé tette számunkra, hogy csináld nyilvánosság akkor közvetlenül vele: celineduboi01@gmail.com ő készen áll, hogy megfeleljen ezeknek az ügyfeleknek 72 órán belül a kérésüket. E-mail: celineduboi01@gmail.com

Feladva: 2016-02-09 19:57:21    

Hi minden kedves barát Szeretnénk megosztani örömünket. Mi nagyon bosszantott az elmúlt hónapokban a házunk majdnem elveszett, mert a nyújtott kölcsön bankunk által a ráta nagyon nehéz elviselni. Egy barátja a férjem ajánlott minket egyik munkatársa, aki specializálódott hitel problémák és finanszírozás. Nagyon gyors ez segített nekünk, ha egy gyors kölcsön 3 napig így tiszteljük adósságok a bank felé, és megadta nekünk időtartamra teljesen ésszerű visszafizetni. Soha nem volt az a fajta ... további részletek >>

szerencse az életünkben, és mi nem az egyetlen, élvezni, mert tudom, hogy sok más ember, mint ahogy azt igénybe ezt a hitelt, anélkül, hogy a bankok, azok könyörtelen. ezt a lehetőséget mi lehetővé tette számunkra, hogy csináld nyilvánosság akkor közvetlenül vele: celineduboi01@gmail.com ő készen áll, hogy megfeleljen ezeknek az ügyfeleknek 72 órán belül a kérésüket. E-mail: celineduboi01@gmail.com

Feladva: 2016-02-09 19:55:04    

Pektin tartalmú ital - a fogyáshoz Meggyógyítja a szervezetet Kiüríti a nehézfémek sóit Kiüríti a zsírt A specialisták a pektint a szervezetünk természetes «szanitécjének» nevezik, mert az adott anyag olyan képességekkel rendelkezik amely kiüríti a káros anyagokat: a peszticideket, a nehézfémek sóit, radionuklidokat, úgy hogy közben nem borítja fel a szervezet természetes bakteriológiai egyensúlyát.
A hirdetés részletei >>

Feladva: 2016-02-09 18:08:41    

Speciális gyógyászati célra szánt tápszer! A készítmény alkalmazása javasolt tüdő (C34), emlő (C50) és myeloid leukémia (C92) rosszindulatú daganatos betegségek kezelésére. Az artemisininről mára a tudósok bebizonyították, hogy ez a csodálatos növény hatásos a rák elleni küzdelemben is.
A hirdetés részletei >>

Feladva: 2016-02-09 15:18:06    

Címkék, kulcsszavak: flavin7 artemisininmyeloid leukémiarák

A nagylábujjon kitüremkedő csontocska – sokak által ismert jelenség. A problémának nem csak esztétikai jellege van. A lábfej deformációja nem egyszerűen elrondítja a lábat, kellemetlen érzést is okoz, fájdalmat okoz járás közben és a lábbeliválasztást valóságos próbatétté változtatja. a szakemberek kidolgozták a “Valgus Pro” speciális nagylábujj-rögzítőt. Fő rendeltetése – lecsökkenteni a nagylábujj környékén történő traumatikus behatást, ezzel együtt leállítani a fáj
A hirdetés részletei >>

Feladva: 2016-01-29 19:58:40    

Középméretü, sachseni székhelyü vállalat számára, mely haszongépjármü-fülke fejlesztésére és gyártására specializálódott, keresünk azonnali kezdéssel mechatronikust, gépjármülakatost (férfi/nö) Az Ön feladatai: - A szerelési megbízások végrahajtása a napi termelésgyártás követelményei alapján - Elkészítési állvány vázának a szállítóállványra helyezése (szükség esetén szállítítóállvány készítése, illetve javítása) - A munkafolyamatot a szerkezeti vázlat alapján megállapítani - A szerk
A hirdetés részletei >>

Feladva: 2016-01-21 16:27:43    

Középméretü, sachseni székhelyü vállalat számára, mely haszongépjármü-fülke fejlesztésére és gyártására specializálódott, keresünk azonnali kezdéssel mechatronikust, gépjármülakatost (férfi/nö) Az Ön feladatai: - A szerelési megbízások végrahajtása a napi termelésgyártás követelményei alapján - Elkészítési állvány vázának a szállítóállványra helyezése (szükség esetén szállítítóállvány készítése, illetve javítása) - A munkafolyamatot a szerkezeti vázlat alapján megállapítani - A ... további részletek >>

szerkezeti váz vizuális ellenörzése (pl. színezés hiánya esetén), hiány esetén információ az elömunkásnak, a mesternek, vagy a minöségbiztosító dolgozónak - Közepes felszereltségü karosszériák csatlakozásra kész összeszerelése a konstrukciós dokumentumok alapján, villamos és machanikus komponensek beépítésével - Különbözö anyagok ragasztása elöírt technológia alapján - Nehezen illeszthetö szerelési részek összeillesztése - Fúrások és áttörések létrehozása (fúrás menettel és menet nélkül), amelyeket csak a szerelés során hoznak létre - Ellenörzölista ledolgozása és a vizsgaprotokoll vizsgálata (önellenörzés) - A hibák okainak megállapítása és a hibák megszüntetése, beleértve a hibamegszüntetés dokumentálását, illetve javíthatatlan hibák jelentését a minöségbiztosítási kollégának - A kakorsszéria szállítóképes állapotba hozása (védöfóliával ellátása) - Szükséges munkadokumentumok kitöltése - Saját munkaeszköz ápolása, karbantartása - A munkavédelmi, balesetvédelmi és megelözési vonatkozó irányelvek és elöírások betartása Az Ön profilja: - Befejezett végzettség lakatosként, gépjármü-lakatosként, mechatronikusként, vagy hasonló végzettség - Szakmai tapasztalat - Önálló, felelösségtudatos munkamód - Hajlandóság müszakokban való munkavégzésre - Flexibilitás, autó és jogosítvány elöny Amit kínálunk - Jó szociális teljesítmény, beleértve a karácsonyi és szabadágpénzt, müszakpótlékot - Átvételi lehetöség ügyfelünktöl - Személyes gondviselés és tanácsadás a kihelyezett telephelytöl - 10 Euro/óra bruttó órabér, plusz szakmai hozzájárulás (max 11,02 Euró) - A német nyelv alapos alapszintü ismerete (írásban és szóban, A2-es szint) - Ingyenes szállás az elsö két hónapban - Várjuk jelentkezését az alábbi címre. Jelentkezéséhez küldje el német nyelvü önéletrajzát és pályázati dokumentumait az alábbi címre: munka-nemetorszag@randstad.de

Feladva: 2016-01-21 11:49:51    

Címkék, kulcsszavak: Németországmechatronikusgépjármülakatos

Online tanfolyam! Szakmai elmélet saját otthonában, interneten, speciális tananyaggal. Szakmai gyakorlati hely választható. Idő és költségmegtakarítás! Középfokú szakképzettség 10 hónap alatt! Ára: 120 000 Ft és 50 000 Ft vizsgadíj, kamatmentes részletfizetéssel. Ingyenes modulzáró vizsgák, kidolgozott tételek, kedvezmények! Europass kiváltható. Humánorientáció, jelentkezési kód: H-089
A hirdetés részletei >>

Feladva: 2016-01-20 17:29:15    

Címkék, kulcsszavak: OKJszociálisgondozóápolószakképzésonlinetanfolyamtávoktatás

Online képzésünkkel otthonában, családi környezetben tanulhat! Ideális munka mellett tanulóknak, kisgyermekeseknek, elfoglaltaknak. Szakmai elmélet az interneten, speciális tananyaggal. A szakmai gyakorlat egyénileg választott intézményben. Ár: 120 000 + 50 000 Ft vizsgadíj, kamatmentes részletfizetéssel. Akciók, kedvezmények! Képzési idő 8 hónap. Humánorientáció, jelentkezési kód: H-089. Koordinátor Hangyáné.
A hirdetés részletei >>

Feladva: 2016-01-19 15:47:51    

Címkék, kulcsszavak: OKJpedagógiaiasszisztenscsaládsegítőmunkatársszakképzésonlinetanfolyam

Online tanfolyami képzés! Szakmai elmélet saját otthonában, interneten az esti órákban, speciális tananyaggal. Szakmai gyakorlat egyénileg választott óvodában. Utazni csak a vizsgára kell! Ideális kisgyermekeseknek, munka mellett tanulóknak. Képzési idő 5 hónap. Ár: 60 000 és 30 000 Ft vizsgadíj, részletfizetéssel Elhelyezkedés: óvoda, családi napközi, bébiszitter. Humánorientáció, kód: H-089, koordinátor Hangyáné.
A hirdetés részletei >>

Feladva: 2016-01-19 15:38:10    

Címkék, kulcsszavak: OKJóvodaidajkaszakképzésonlinetanfolyamtávoktatásbébiszitter

Online tanfolyami képzés! Szakmai elmélet saját otthonában, interneten az esti órákban, speciális tananyaggal. Szakmai gyakorlat egyénileg választott óvodában. Utazni csak a vizsgára kell! Ideális kisgyermekeseknek, munka mellett tanulóknak. Képzési idő 5 hónap. Ár: 60 000 és 30 000 Ft vizsgadíj, részletfizetéssel Elhelyezkedés: óvoda, családi napközi, bébiszitter. Humánorientáció, kód: H-089, koordinátor Hangyáné.
A hirdetés részletei >>

Feladva: 2016-01-19 15:37:18    

Címkék, kulcsszavak: OKJóvodaidajkaszakkéépzésonlinetanfolyamtávoktatásbébiszitter

Otthonában, családi környezetben tanulhat! Szakmai elmélet interneten, speciális tananyaggal. Gyakorlat választott intézményben is teljesíthető. Utazni csak a vizsgára kell. Emelt szintű, középfokú szakképzettség 10 hónap alatt (érettségi szükséges). Ár: 200 000 Ft és 50 000 Ft vizsgadíj, kamatmentes részletfizetéssel. Ingyenes modulzáró vizsgák, kidolgozott tételek. Akciók, kedvezmények! Humánorientáció, jelentkezési kódszám: H-089.
A hirdetés részletei >>

Feladva: 2016-01-19 15:24:29    

Címkék, kulcsszavak: OKJkisgyermekgondozónevelőszakképzésonlinetanfolyam

A nagylábujjon kitüremkedő csontocska – sokak által ismert jelenség. A problémának nem csak esztétikai jellege van. A lábfej deformációja nem egyszerűen elrondítja a lábat, kellemetlen érzést is okoz, fájdalmat okoz járás közben és a lábbeliválasztást valóságos próbatétté változtatja. A szélsőséges intézkedésektől, a szakemberek kidolgozták a “Valgus Pro” speciális nagylábujj-rögzítőt.. Fő rendeltetése – lecsökkenteni a nagylábujj környékén történő traumatikus behatás
A hirdetés részletei >>

Feladva: 2016-01-08 21:34:16    

A masszázst szülés után két hónappal ajánlott elkezdeni, mert ekkorra már beállt a tejelválasztás. A szoptatás idején kerülni kell az intenzív masszázs­fogásokat, mert a felszabaduló anyagcseretermékek az anyatejbe juthatnak. Az anyuka egy finom, 60 perces kényeztető masszázst kap, speciális fogásokkal, enyhébb erősséggel, odafigyelve arra,hogy a háton a baba gondozása, ellátása során leginkább igénybe vett izmoknak valóban segítséget nyújtson, kilazítja és fájdalmat csillapít egyben ez a masszá
A hirdetés részletei >>

Feladva: 2015-12-04 11:01:17    

360 fokos vonallézer és függőző RÉSZLETEK, ADATOKCIKKSZÁM Vízszintes vonal 360°-ban, 2 db függőleges vonal egymással 90°-ban, függőző pontok lefelé és fölfelé fölfelé. Kihúzható láb, speciális ütéselnyelő gumiburkolat. A függőleges vonalak finombeállítása lehetséges. A Rec 210 speciális vevőegységgel kültérben is használható. Lézerosztály: 2. Teljesítmény: < 1 mW. Hullámhossz:635 nm. Önbeálló tartomány: approx. +/- 4°. Szintezési pontosság +/- 0,3 mm/m. Vonalegyenesség: +-0,2 mm/m. A 9
A hirdetés részletei >>

Feladva: 2015-12-01 13:43:06    

Címkék, kulcsszavak: szintezőteodolitépítőipari és geodéziai mérési eszközök

Eladó ez a Svájcban vásárolt, alig használt ágy, a hozzátartozó speciális, lábnál és a fej résznél állítható ágyráccsal és matraccal. A mérete 140x200.
A hirdetés részletei >>

Feladva: 2015-11-17 10:31:21    

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-10-25 10:09:53    

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-10-25 09:19:24    

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-10-25 09:19:18    

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-10-25 09:14:27    

Termékjellemzők: – Térhálós POLYMER® fejszerelvény és nyomókar – Speciális hátoldali fali függesztő – Műanyag talpgyűrű – Ergonomikus tömlőmarkolat a biztos irányíthatóságért Oltási teljesítmény: 34A 144B C Oltóanyag-egység: 10/9 Szabvány EN 3-7:2004 Tűzvédelmi Megfelelőségi Tanúsítvány: SP 42/10 Oltóanyag: 6 kg BAVARIA SPECIAL SP 86/09 Hajtóanyag: Nitrogén Szélesség: 165 mm Magasság: 550 mm Békéscsaba, Debrecen, Szeged
A hirdetés részletei >>

Feladva: 2015-10-19 21:45:02    

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-10-12 12:17:13    

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-10-12 11:14:32    

Hogyan válhatsz fiatalként, felnőttként, idősebb emberként Homo Vividus-sá? = életerős, élénk, eleven, tüzes, szuper egészséges. Gelencsér György, biológiai sejtjavító és megújító specialista vagyok. Nézd meg a Napharcos honlapot!
A hirdetés részletei >>

Feladva: 2015-10-08 14:28:49    

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-10-03 10:52:07    

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-10-03 10:39:23    

Kórházi fekvést nem igénylő, gyorsan és kíméletesen elvégezhető gumigyűrűs lekötés, kezelés Budapesten. Mára ennek modern formáját végzik a legnagyobb számban a világon. Az eljárás lényege, hogy egy speciális eszköz segítségével gumigyűrűt helyezünk a megnyúlt, vérrel teli nyálkahártya többletre, így az aranyér 5-10 nap alatt elhal, a nyálkahártya pedig az izomzathoz rögzül. Az eljárás sikeressége meghaladja a 95 százalékot. Weboldal: http://aranyer-kezelese.hu
A hirdetés részletei >>

Feladva: 2015-10-01 21:48:12    

Stabila LAX50 keresztvonal lézer (automata) állvánnyal RÉSZLETEK, ADATOKCIKKSZÁM Önbeálló LAX50 keresztvonal lézer beltéri kivitelezési munkák megkönnyítésére. Hatótávolság: 10 m Pontosság: ±0,5 mm/m A kompenzátor működési tartománya: ± 4,5° Teljesítmény: < 1 mW, lézer hullámhossz: 635 nm Üzemidő: >25 óra Tápegység: 3 db AA méretű alkáli elem Súly: 258 g Tartozék: Speciális, teleszkóprúddá alakítható állvány, elemek
A hirdetés részletei >>

Feladva: 2015-09-29 09:31:35    

Címkék, kulcsszavak: szintezőteodolitépítőipari és geodéziai mérési eszközök

2/ Értékesítésben jártas munkatársakat keresek egy speciális termék magyarországi és külföldi értékesítéséhez! A rendkívül dinamikus fejlődésnek köszönhetően jelenleg a világ 20 országában vagyunk jelen(Szerbia,Románia,Macedonia,Hol landia,Oroszország,Bosznia(mind két tartomány),Horvátország,Montenegró, Magyarország,Austria,Németország,Tö rökország,Szlovénia,Benelux államok, Örményország,Koszovó,Ukrajna,Szlová kia. Jelenleg a következő ország kiépítését kezdtük el, mely hatalmas piac: Lengyelors
A hirdetés részletei >>

Feladva: 2015-09-24 19:02:15    

Eladó egy felújított, állványos oszlopos fúrógép. Specifikació: tipus: GYF 35 -állítható körasztal -állítható fúrófej -MK-4 morsekúp - dahlander motor 0,8-1,9kw Fordulat: 120-1200f/perc előtolás: 0,07-0,2mm/foerdulat lökethossz: 170mm
A hirdetés részletei >>

Feladva: 2015-09-24 10:51:28    

360 fokos vonallézer és függőző RÉSZLETEK, ADATOKCIKKSZÁM Vízszintes vonal 360°-ban, 2 db függőleges vonal egymással 90°-ban, függőző pontok lefelé és fölfelé fölfelé. Kihúzható láb, speciális ütéselnyelő gumiburkolat. A függőleges vonalak finombeállítása lehetséges. A Rec 210 speciális vevőegységgel kültérben is használható. Lézerosztály: 2. Teljesítmény: < 1 mW. Hullámhossz:635 nm. Önbeálló tartomány: approx. +/- 4°. Szintezési pontosság +/- 0,3 mm/m. Vonalegyenesség: +-0,2 mm/m. A 9
A hirdetés részletei >>

Feladva: 2015-09-22 09:31:50    

Címkék, kulcsszavak: szintezőteodolitépítőipari és geodéziai mérési eszközök

Mennyit érnek és mire használhatóak fel a TP Tőzsdearanypontok? Akár Forintra is válthatók? A TP Tőzsdearanypontok felhasználhatóak egyes szolgáltatásaink árának részleges, vagy teljes csökkentésére! A pontokat speciális vásárlásra is felhasználhatod. Erről részletek később. A szükséges feltételeknek eleget tevők a hatékony TP Tőzsdearanypontokat - IGEN - Forintra is válthatják....
A hirdetés részletei >>

Feladva: 2015-09-02 10:12:53    

Címkék, kulcsszavak: gazdagodáspénzgazdagságtőzsde

Mennyit érnek és mire használhatóak fel a TP Tőzsdearanypontok? Akár Forintra is válthatók? A TP Tőzsdearanypontok felhasználhatóak egyes szolgáltatásaink árának részleges, vagy teljes csökkentésére! A pontokat speciális vásárlásra is felhasználhatod. Erről részletek később. A szükséges feltételeknek eleget tevők a hatékony TP Tőzsdearanypontokat - IGEN - Forintra is válthatják....
A hirdetés részletei >>

Feladva: 2015-08-31 11:38:27    

Címkék, kulcsszavak: gazdagodáspénzgazdagságtőzsde

A flavonoidok nagy segítséget nyújthatnak daganatos betegeknek, a hagyományos kezelések kiegészítéseként, kemoterápia mellékhatásainak csökkentésére, továbbá mindenkinek daganatos betegségek megelőzésére. A szervezetet feltölti energiával,és antioxidáns hatásánál fogva felveszi a harcot a szabad gyökökkel, és a rákos sejtekkel. A Flavin7 italokban koncentráltan találhatók meg a flavonoidok. Az egyik legjobb termék a Flavin7 Jubileum ital 1000 ml, házhoz szállítása ingyenes Magyarországon.
A hirdetés részletei >>

Feladva: 2015-08-22 16:02:28    

Címkék, kulcsszavak: flavinflavin7falvinboltdaganatrák

Formálja alakját szeptembertől induló speciális tornaóráinkon egy kellemes, családias csoportban. Ár: 700 ft
A hirdetés részletei >>

Feladva: 2015-08-17 19:18:06    

Vegye fel a küzdelmet a daganattal,úgy hogy segít a szervezetének abban hogy szembeszállhasson a rákos sejtekkel. A lúgos szervezetet nem szeretik a betegségek,ez azt jelenti hogy lúgosítani kell,például lucerna kapszulával, és olyan anyagokat kell a szervezetbe juttatni melyek feltöltik energiával,mint például a flavonoidok. Árban az egyik legjobb flavonoidokkal teli termékünk a Flavin7 ital 200ml x32db specialized, ami majdnem 6 és fél liter koncentrátum,7 féle sötét gyümölcs levéből.
A hirdetés részletei >>

Feladva: 2015-08-17 19:13:20    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

Vegye fel a küzdelmet a daganattal,úgy hogy segít a szervezetének abban hogy szembeszállhasson a rákos sejtekkel. A lúgos szervezetet nem szeretik a betegségek,ez azt jelenti hogy lúgosítani kell,például lucerna kapszulával, és olyan anyagokat kell a szervezetbe juttatni melyek feltöltik energiával,mint például a flavonoidok. Árban az egyik legjobb flavonoidokkal teli termékünk a Flavin7 ital 200ml x32db specialized, ami majdnem 6 és fél liter koncentrátum,7 féle sötét gyümölcs levéből.
A hirdetés részletei >>

Feladva: 2015-08-17 19:11:19    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

Vegye fel a küzdelmet a daganattal,úgy hogy segít a szervezetének abban hogy szembeszállhasson a rákos sejtekkel. A lúgos szervezetet nem szeretik a betegségek,ez azt jelenti hogy lúgosítani kell,például lucerna kapszulával, és olyan anyagokat kell a szervezetbe juttatni melyek feltöltik energiával,mint például a flavonoidok. Árban az egyik legjobb flavonoidokkal teli termékünk a Flavin7 ital 200ml x32db specialized, ami majdnem 6 és fél liter koncentrátum,7 féle sötét gyümölcs levéből.
A hirdetés részletei >>

Feladva: 2015-08-17 19:09:52    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

Vegye fel a küzdelmet a daganattal,úgy hogy segít a szervezetének abban hogy szembeszállhasson a rákos sejtekkel. A lúgos szervezetet nem szeretik a betegségek,ez azt jelenti hogy lúgosítani kell,például lucerna kapszulával, és olyan anyagokat kell a szervezetbe juttatni melyek feltöltik energiával,mint például a flavonoidok. Árban az egyik legjobb flavonoidokkal teli termékünk a Flavin7 ital 200ml x32db specialized, ami majdnem 6 és fél liter koncentrátum,7 féle sötét gyümölcs levéből.
A hirdetés részletei >>

Feladva: 2015-08-17 09:45:29    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

A flavonoidok nagy segítséget nyújthatnak daganatos betegeknek, a hagyományos kezelések kiegészítéseként, kemoterápia mellékhatásainak csökkentésére, továbbá mindenkinek daganatos betegségek megelőzésére. A szervezetet feltölti energiával,és antioxidáns hatásánál fogva felveszi a harcot a szabad gyökökkel, és a rákos sejtekkel. A Flavin7 italokban koncentráltan találhatók meg a flavonoidok. Az egyik legjobb termék a Flavin7 Jubileum ital 1000 ml,házhoz szállítása ingyenes egész Magyarországon
A hirdetés részletei >>

Feladva: 2015-08-17 09:23:58    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

A flavonoidok nagy segítséget nyújthatnak daganatos betegeknek, a hagyományos kezelések kiegészítéseként, kemoterápia mellékhatásainak csökkentésére, továbbá mindenkinek daganatos betegségek megelőzésére. A szervezetet feltölti energiával,és antioxidáns hatásánál fogva felveszi a harcot a szabad gyökökkel, és a rákos sejtekkel. A Flavin7 italokban koncentráltan találhatók meg a flavonoidok. Az egyik legjobb termék a Flavin7 Jubileum ital 1000 ml,házhoz szállítása ingyenes egész Magyarországon
A hirdetés részletei >>

Feladva: 2015-08-17 09:21:55    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

A flavonoidok nagy segítséget nyújthatnak daganatos betegeknek, a hagyományos kezelések kiegészítéseként, kemoterápia mellékhatásainak csökkentésére, továbbá mindenkinek daganatos betegségek megelőzésére. A szervezetet feltölti energiával,és antioxidáns hatásánál fogva felveszi a harcot a szabad gyökökkel, és a rákos sejtekkel. A Flavin7 italokban koncentráltan találhatók meg a flavonoidok. Az egyik legjobb termék a Flavin7 Jubileum ital 1000 ml, házhoz szállítása ingyenes egész ... további részletek >>


Feladva: 2015-08-17 09:21:51    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

A flavonoidok nagy segítséget nyújthatnak daganatos betegeknek, a hagyományos kezelések kiegészítéseként, kemoterápia mellékhatásainak csökkentésére, továbbá mindenkinek daganatos betegségek megelőzésére. A szervezetet feltölti energiával,és antioxidáns hatásánál fogva felveszi a harcot a szabad gyökökkel, és a rákos sejtekkel. A Flavin7 italokban koncentráltan találhatók meg a flavonoidok. Az egyik legjobb termék a Flavin7 Jubileum ital 1000 ml,házhoz szállítása ingyenes egész Magyarországon
A hirdetés részletei >>

Feladva: 2015-08-17 09:19:51    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

A flavonoidok nagy segítséget nyújthatnak daganatos betegeknek, a hagyományos kezelések kiegészítéseként, kemoterápia mellékhatásainak csökkentésére, továbbá mindenkinek daganatos betegségek megelőzésére. A szervezetet feltölti energiával,és antioxidáns hatásánál fogva felveszi a harcot a szabad gyökökkel, és a rákos sejtekkel. A Flavin7 italokban koncentráltan találhatók meg a flavonoidok. Az egyik legjobb termék a Flavin7 Jubileum ital 1000 ml, házhoz szállítása ingyenes egész Magyarországo
A hirdetés részletei >>

Feladva: 2015-08-17 08:54:00    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

A flavonoidok nagy segítséget nyújthatnak daganatos betegeknek, a hagyományos kezelések kiegészítéseként, kemoterápia mellékhatásainak csökkentésére, továbbá mindenkinek daganatos betegségek megelőzésére. A szervezetet feltölti energiával,és antioxidáns hatásánál fogva felveszi a harcot a szabad gyökökkel, és a rákos sejtekkel. A Flavin7 italokban koncentráltan találhatók meg a flavonoidok. Az egyik legjobb termék a Flavin7 Jubileum ital 1000 ml, házhoz szállítása ingyenes egész Magyarországo
A hirdetés részletei >>

Feladva: 2015-08-17 08:51:59    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

A flavonoidok nagy segítséget nyújthatnak daganatos betegeknek, a hagyományos kezelések kiegészítéseként, kemoterápia mellékhatásainak csökkentésére, továbbá mindenkinek daganatos betegségek megelőzésére. A szervezetet feltölti energiával,és antioxidáns hatásánál fogva felveszi a harcot a szabad gyökökkel, és a rákos sejtekkel. A Flavin7 italokban koncentráltan találhatók meg a flavonoidok. Az egyik legjobb termék a Flavin7 Jubileum ital 1000 ml, házhoz szállítása ingyenes egész Magyarországo
A hirdetés részletei >>

Feladva: 2015-08-17 08:49:53    

Címkék, kulcsszavak: Flavin7flavinrák megelőzés

MZ-B a motoralkatrész specialista. Vegyen meg mindent egy helyen, kedvező áron. Tekintse meg webáruházunkat: www.mz-b.hu Hatalmas választék--Naponta frissülő árukészlet. Kiszállítás:1-2 Nap - Személyes áruátvétel H-P Keleti típusok: MZ-TS, ETZ, JAWA, SIMSON, BABETTA, CSEPEL, PANNÓNIA, ROMET, RIGA, PUCH Robogók: YAMAHA, APRILIA, HONDA, PIAGGIO, PEUGEOT, MBK, KYMCO, MALAGUTI, PEUGEOT, SUZUKI Motor gumik-belsők: HEIDENAU, SAVA, MITAS, VEE RUBBER Kerékpár gumik-belsők: CONTINENTAL, VEE ... további részletek >>

RUBBER Kellemes vásárlást!

Feladva: 2015-08-06 12:24:16    


Vállaljuk lakások részleges és teljes felújítását. Tetőfedő bádogos,Festés mázolás,Kőműves,burkoló,munkák. Speciális szaképítések teljeskörü anyagbeszerzéssel. Gipszkartonozás, Hő és páratechnikai szigetelések. Leinformálható referenciák. Kisseb Nagyobb Átalkitások :Egyedi igényszerint Elérhetőségeink: 06/33/447090. 0620/6253636. profiepites@gmail.com htt://szlaci.honlapom.com
A hirdetés részletei >>

Feladva: 2015-08-01 19:35:40    

Ez az üzenet célja az egyének , a szegények , vagy azok, akiknek szükségük van egy speciális hitel újjáépíteni az életüket. Keresi a hitelek , hogy növeljék a vállalkozás vagy a projekt , vagy vásárolni egy lakást , de nem bank, vagy abban az esetben elutasította a bank . Különleges vagyok én kölcsönök kezdve fő részére 2000 Ft i 25000000 Ft képes teljesíteni a feltételeket. Nem vagyok egy bank , és nem kell sok dokumentumok bízom benned, de meg kell lennie egy igaz ember , megbízható , őszinte ... további részletek >>

és bölcs. Adok hitelt azoknak, akik élnek az Európában és szerte a világon (Franciaország , Belgium , Kanada, Svájc, Románia , Olaszország, Spanyolország és Portugália ... ) . A kamat mértéke 3%. Ha pénz kell, egyéb okok miatt , ne habozzon kapcsolatba lépni velem a további információkért. Elérhető vagyok találkozni az ügyfelekkel egy olyan időszakban, legfeljebb 3 napon belül a kérését. Amennyiben felkeltettük érdeklődését , kérjük lépjen kapcsolatba velem a további információkért. E-mail : gazdajozsef60@freemail.hu Tisztelettel : József GAZDA

Feladva: 2015-08-01 05:09:58    

RASZTA haj (dreadlock) - készítés (póthajjal is) , - javítás, - karban tartás, - nagygenerál, - hosszabbítás... Sokéves intenzív szakmai tapasztalattal, profiktól, a Westendnél! Speciális, ragacsmentes technikával dolgozunk! Miinden infót megtalálsz http://haircoholix.com/raszta oldalon, időpontért írj a nesta.haircoholic@gmail.com< /a> címre! http://facebook.com/HaircoholiX.Sz alon
A hirdetés részletei >>

Feladva: 2015-07-29 20:30:44    

Címkék, kulcsszavak: rasztarastaraszta készítésrasta készítésrasta javításraszta javításraszta horgolásrasztázásrastázásrasztásításrastásításdreadlock

Stabila LAX50 keresztvonal lézer (automata) állvánnyal RÉSZLETEK, ADATOKCIKKSZÁM Önbeálló LAX50 keresztvonal lézer beltéri kivitelezési munkák megkönnyítésére. Hatótávolság: 10 m Pontosság: ±0,5 mm/m A kompenzátor működési tartománya: ± 4,5° Teljesítmény: < 1 mW, lézer hullámhossz: 635 nm Üzemidő: >25 óra Tápegység: 3 db AA méretű alkáli elem Súly: 258 g Tartozék: Speciális, teleszkóprúddá alakítható állvány, elemek RedGhost Building Trade Kft. Címünk: 2051 Biatorbá
A hirdetés részletei >>

Feladva: 2015-07-29 08:37:29    

Címkék, kulcsszavak: szintezőteodolitépítőipari és geodéziai mérési eszközök

Amennyiben Ön túl fáradt vagy túl elfoglalt ahhoz, hogy kozmetikushoz menjen, nincs elég ideje ott várakozni…..munka vagy gyermekei mellett, akkor Hívjon Engem Bizalommal! Szépüljön Velem Otthona Kényelmében! Kozmetikus szakemberként pár perc alatt otthonába tudom varázsolni a szalon hangulatát. Elfoglalt Nőknek, Kisgyermekes Anyukáknak, Nyugdíjas Hölgyek, Mindenkinek ajánlott akinek kozmetikai kezelésre van szüksége! Klasszikus arckezelések személyre szabottan ( ... további részletek >>

letisztítás, peeling, arcmasszázs, regeneráló maszk) - Fiatalító, Bőrfeltöltő kezelések hyaluronsavval, kollagénnel - Frissítő, Energizáló kezelés Vitaminkoktéllal - Mélyhidratáló, Nyugtató kezelések gyógynövénnyel, zöld tea kivonattal - Relaxáló, speciális kezelések (Csokoládé mélyhidratáló maszk, kaviáros bőrkisimítómaszk) - Szempilla festés, Szemöldök festés, formázás - Ultrahangos hatóanyagbevitel - Bőrfeszesítő, Anyagcserefokozó cellulit kezelések Budapesten és környékén házhoz megyek, Hívjon Bizalommal az alábbi számon: +3630-433-87-52

Feladva: 2015-07-28 07:07:01    

Címkék, kulcsszavak: kozmetikuskozmetikakozmetikus házhozkozmetikus otthon

Amennyiben Ön túl fáradt vagy túl elfoglalt ahhoz, hogy kozmetikushoz menjen, nincs elég ideje ott várakozni…..munka vagy gyermekei mellett, akkor Hívjon Engem Bizalommal! Szépüljön Velem Otthona Kényelmében! Kozmetikus szakemberként pár perc alatt otthonába tudom varázsolni a szalon hangulatát. Elfoglalt Nőknek, Kisgyermekes Anyukáknak, Nyugdíjas Hölgyek, Mindenkinek ajánlott akinek kozmetikai kezelésre van szüksége! Klasszikus arckezelések személyre szabottan ( ... további részletek >>

letisztítás, peeling, arcmasszázs, regeneráló maszk) - Fiatalító, Bőrfeltöltő kezelések hyaluronsavval, kollagénnel - Frissítő, Energizáló kezelés Vitaminkoktéllal - Mélyhidratáló, Nyugtató kezelések gyógynövénnyel, zöld tea kivonattal - Relaxáló, speciális kezelések (Csokoládé mélyhidratáló maszk, kaviáros bőrkisimítómaszk) - Szempilla festés, Szemöldök festés, formázás - Ultrahangos hatóanyagbevitel - Bőrfeszesítő, Anyagcserefokozó cellulit kezelések Budapesten és környékén házhoz megyek, Hívjon Bizalommal az alábbi számon: +3630-433-87-52

Feladva: 2015-07-28 07:06:45    

Címkék, kulcsszavak: kozmetikuskozmetikakozmetikus házhozkozmetikus otthon

Ez az üzenet célja az egyének , a szegények , vagy azok, akiknek szükségük van egy speciális hitel újjáépíteni az életüket. Keresi a hitelek , hogy növeljék a vállalkozás vagy a projekt , vagy vásárolni egy lakást , de nem bank, vagy abban az esetben elutasította a bank . Különleges vagyok én kölcsönök kezdve fő részére 2000 Ft i 25000000 Ft képes teljesíteni a feltételeket. Nem vagyok egy bank , és nem kell sok dokumentumok bízom benned, de meg kell lennie egy igaz ember , megbízható , őszinte ... további részletek >>

és bölcs. Adok hitelt azoknak, akik élnek az Európában és szerte a világon (Franciaország , Belgium , Kanada, Svájc, Románia , Olaszország, Spanyolország és Portugália ... ) . A kamat mértéke 3%. Ha pénz kell, egyéb okok miatt , ne habozzon kapcsolatba lépni velem a további információkért. Elérhető vagyok találkozni az ügyfelekkel egy olyan időszakban, legfeljebb 3 napon belül a kérését. Amennyiben felkeltettük érdeklődését , kérjük lépjen kapcsolatba velem a további információkért. E-mail : gazdajozsef60@freemail.hu Tisztelettel : József GAZDA

Feladva: 2015-07-25 14:42:20    

Stabila LAX50 keresztvonal lézer (automata) állvánnyal RÉSZLETEK, ADATOKCIKKSZÁM Önbeálló LAX50 keresztvonal lézer beltéri kivitelezési munkák megkönnyítésére. Hatótávolság: 10 m Pontosság: ±0,5 mm/m A kompenzátor működési tartománya: ± 4,5° Teljesítmény: < 1 mW, lézer hullámhossz: 635 nm Üzemidő: >25 óra Tápegység: 3 db AA méretű alkáli elem Súly: 258 g Tartozék: Speciális, teleszkóprúddá alakítható állvány, elemek RedGhost Building Trade Kft. Címünk: 2051 Biatorbá
A hirdetés részletei >>

Feladva: 2015-07-15 11:16:14    

Címkék, kulcsszavak: szintezőteodolitépítőipari és geodéziai mérési eszközök

Stabila LAX50 keresztvonal lézer (automata) állvánnyal RÉSZLETEK, ADATOKCIKKSZÁM Önbeálló LAX50 keresztvonal lézer beltéri kivitelezési munkák megkönnyítésére. Hatótávolság: 10 m Pontosság: ±0,5 mm/m A kompenzátor működési tartománya: ± 4,5° Teljesítmény: < 1 mW, lézer hullámhossz: 635 nm Üzemidő: >25 óra Tápegység: 3 db AA méretű alkáli elem Súly: 258 g Tartozék: Speciális, teleszkóprúddá alakítható állvány, elemek RedGhost Building Trade Kft. Címünk: 2051 Biatorbá
A hirdetés részletei >>

Feladva: 2015-07-15 10:03:21    

Címkék, kulcsszavak: szintezőteodolitépítőipari és geodéziai mérési eszközök

Stabila LAX50 keresztvonal lézer (automata) állvánnyal RÉSZLETEK, ADATOKCIKKSZÁM Önbeálló LAX50 keresztvonal lézer beltéri kivitelezési munkák megkönnyítésére. Hatótávolság: 10 m Pontosság: ±0,5 mm/m A kompenzátor működési tartománya: ± 4,5° Teljesítmény: < 1 mW, lézer hullámhossz: 635 nm Üzemidő: >25 óra Tápegység: 3 db AA méretű alkáli elem Súly: 258 g Tartozék: Speciális, teleszkóprúddá alakítható állvány, elemek RedGhost Building Trade Kft. Címünk: 2051 Biatorbá
A hirdetés részletei >>

Feladva: 2015-07-15 09:25:01    

Címkék, kulcsszavak: szintezőteodolitépítőipari és geodéziai mérési eszközök

Eladó egy felújított dahlander álványos oszlopos fúrógép. Specifikació tipus: GYF 35 -állítható körasztal -állítható fúrófej -MK-4 morsekúp - dahlander motor 0,8-1,9kw Fordulat: 120-810f/perc előtolás: 0,07-0,2mm/foerdulat lökethossz: 170mm
A hirdetés részletei >>

Feladva: 2015-07-04 11:46:22    

Vállaljuk lakások részleges és teljes felújítását. Tetőfedő bádogos,Festés mázolás,Kőműves,burkoló,munkák. Speciális szaképítések teljeskörü anyagbeszerzéssel. Gipszkartonozás, Hő és páratechnikai szigetelések. Leinformálható referenciák. Kisseb Nagyobb Átalkitások :Egyedi igényszerint Elérhetőségeink: 06/33/447090. 0620/6253636. profiepites@gmail.com htt://szlaci.honlapom.com
A hirdetés részletei >>

Feladva: 2015-07-02 22:48:27    

Eladó a címben említett profi iratmegsemmisítő Új! Csak tesztelés céljából volt kipróbálva. Eredeti dobozában tartozékaival együtt. Tipus: H-8C Specifikációk: Lapkapacitás 8 lap Vágás Konfetti Vágás méret 4x35 mm Papíradagoló szélessége 220 mm Biztonsági szint DIN P-4 Papírkosár kapacitása 14 liter Egyéb megsemmisíthető anyagok Bankkártyagemkapocstűzőkapocs Jam Blocker technológia Nem Safety Lock Safety Lock” biztonsági zár Igen Slientshred technológia. Nem Safesense technoló
A hirdetés részletei >>

Feladva: 2015-06-30 14:10:34    

Totósok figyelem! 12 háromesély vezetve, 1 kétesély bontva, 6 vezetéstől 13-as eséllyel, 32 kombinációs szelvényen, öt változatban 126, 142, 182, 254 és 382 oszlopon játszható. Elláttuk részletes tippelési tanácsokkal, bemutató játékkal és felhasználható mintasorokkal, melyeket csak be kell másolni a játékos által kiválasztott helyükre. Az 5 kulcsot tartalmazó 24 oldalas füzet ára 2500 Ft + postaköltség. Dr. Varga Sándor 2120 Dunakeszi Barátság u. 39. VII/44. T: 27/342-752,30/261-75
A hirdetés részletei >>

Feladva: 2015-06-20 18:53:12    

Totósok figyelem! 12 háromesély vezetve, 1 kétesély bontva 6 vezetéstől 13-as eséllyel, 32 kombinációs szelvényen, öt változatban 126, 142, 182, 254 és 382 oszlopon játszható. Elláttuk részletes tippelési tanácsokkal, bemutató játékkal és felhasználható mintasorokkal, melyeket csak be kell másolni a játékos által kiválasztott helyükre. Az 5 kulcsot tartalmazó 24 oldalas füzet ára 2500 Ft + postaköltség. Dr. Varga Sándor 2120 Dunakeszi Barátság u. 39. VII/44. T: 27/342-752, 30/261-75
A hirdetés részletei >>

Feladva: 2015-06-20 18:32:37    

Totósok figyelem!!!12 háromesély vezetve, 1 kétesély bontva, 6 vezetéstől 13-as eséllyel, 32 kombinációs szelvényen, öt változatban 126, 142, 182, 254 és 382 oszlopon játszható. Elláttuk részletes tippelési tanácsokkal, bemutató játékkal és felhasználható mintasorokkal, melyeket csak be kell másolni a játos által kiválasztott helyükre. Az 5 kulcsot tartalmazó 24 oldalas füzet 2500 Ft + postaköltség. Dr. Varga Sándor 2120 Dunakeszi, Barátság u. 39. VII44. 06-27-342-752 06-30-261-7572
A hirdetés részletei >>

Feladva: 2015-06-20 11:01:12    


tegnap, 2 napja, 3 napja, 4 napja, 5 napja, 6 napja


•   XBOX 360   •   pc bolt   •   fém   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360   •   hűtő   •   olcsó garancia   •   kiállitás   •   eps   •   vas eladó   •   Bál   •   eladó ház   •   kerék   •   UE 28   •   vasarlas   •   tart 1   •   füvesítés   •   ecomaxpoweredbyaltoc ms   •   1000poweredbyaltocms boldog   •   CAT   •   Bál1111111111111"   •   tart 11111111111111"   •   tart 11111111111111   •   költöztetés   •   about:blank   •   toll összeszerelés   •   német   •   Bál1111111111111   •   hitel   •   masszazs   •   tv   •   lcd   •   apolo   •   nyíregyháza   •   1.5   •   magánhitel   •   nyelv   •   Eladó   •   paypal   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3)))   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3))   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3)   •   xbox 360 && SLEEP(3) oRDeR BY 638 #   •   si cu   •   olcsó családi ház   •   szabads   •   kisebb   •   dealkodex   •   traktor xmlrpc php   •   bďż˝dogos esztergom   •   freedom  

TOP keresések

•   állás munka   •   ingatlan   •   honlap készítés   •   ingyen zene   •   ingyen játékok   •   olcsó weboldal   •   apróhirdetés   •   weboldal készítés   •   facebook   •   ingyen hirdetés   •   ingyen apróhirdetés   •   vacsoracsata   •   térkép   •   youtube   •   iwiw   •   magyarország   •   mobilbarát honlap   •   honlap olcsón   •   budapest   •   ingyen   •   szótár  

Most keresik

•   felmenni   •   zellweger   •   claude   •   ďż˝rizetben   •   ďż˝gyaszhatďż˝ ďż˝lďż˝garnitura   •   cibrabqspijsefuftjoh   •   OT C825   •   alig használt   •   tzzie11663 txt   •   eszkozt   •   struktúráját   •   sebek ke   •   Sebestyén   •   Snapdragon   •   bármikorra   •   kútfúrás hajdú bihar   •   ój   •   Ä?Â?TI   •   Hummelg   •   anionindexphpadminis tratorcomponentscust omeraccountvirtueopt ioncomjanews   •   lakatos Ferihegy   •   Plc   •   sz l stelep   •   Könyvelői szolgáltatás   •   Napelemes tanfolyam infrafűtés   •   pihenő idő   •   vin   •   aaaaaaaaacgaaaaaaaaa cs   •   könyv eladás vásárlás   •   nulla   •   Mogul   •   haszongďĹźË p   •   kďż˝pesek   •   börtönr l   •   7 le kistraktor   •   hďż˝nap   •   bejelentettmunkanyir   •   biztosítókra   •   alagutakban   •   dió2121121121212.1   •   palackozó   •   beton keverés   •   frissc4202020c42020c   •   Mostüzlet2010januárj   •   63740ll63740stkn6374 0 l   •   de befektetésreisalkalm as   •   LAPOSTETŐ SZIGETELŐ   •   balk   •   szoftverfejesztďż˝s   •   biztonságiajtózárcse