f

A konkurenciát úgy tarthatja maga mögött, hogy többet, hatékonyabban hirdeti vállalkozását, szolgáltatását, termékeit. BannerHirdetésünknek köszönhetően, az ÖN hirdetése, reklámja közel FÉLMILLIÓ EMBER a szeme elé kerülhet. Honlapja, cége, vállalkozása velünk folyamatosan az internetezők szeme előtt lesz, így nem kell többet foglalkozni a reklámozással. www.bannerhirdetes.azcentrum.com
A hirdetés részletei >>


Feladva: 2015-05-08 19:55:33    

Növelje forgalmát úgy, hogy csak 5 percet dolgozik érte!!! Spórolja meg azt a drága időt, energiát, amit honlapja, vállalkozása népszerűsítésére szokott feláldozni, és legyen többet családjával, vagy szenteljen több időt hobbijának. A munkát rendszerünk átvállalja, és dolgozik Ön helyett. www.bannerhirdetes.firmcenter.com< /a>
A hirdetés részletei >>


Feladva: 2015-05-08 19:48:22    

Folyamatosan hirdetjük cégét, vállalkozását, honlapját 50 apróhirdetési oldalon + akár 15.000 Ft értékû hirdetés kiemelést kap ajándékba. Hirdetésfeladási szolgáltatásunk segítségével feladjuk Ön helyett a hirdetéseket, hirdetjük, reklámozzuk termékeit, szolgáltatásait, hogy másra is maradjon elég ideje. www.hirdetesfeladas.firmcenter.com
A hirdetés részletei >>


Feladva: 2015-05-08 19:40:41    

Percek alatt elkészítheti saját honlapját, weboldalát egyszerűen, szaktudás nélkül. Új egyedülálló honlap szerkesztő rendszer több száz egyszerűen beállítható grafikai sablonnal. A regisztráció előtt egyszerűen megszerkesztheti honlapja, weboldala alap elemeit, így elég ez után eldönteni regisztrál-e. www.idreampage.com
A hirdetés részletei >>


Feladva: 2015-05-08 19:37:27    

Mobilbarát és keresőoptimalizált honlapok, weboldalak készítése olcsón, magas színvonalon rövid határidővel. A weboldalak a legújabb technológiákat, trendeket követve, reszponzív technikával készülnek, így a weboldalak minden eszközön (számítógép, okostelefon, tablet) megjelennek. - Céges bemutatkozó weboldal - Webáruház, webshop - Ingatlanközvetítő portál - Apróhirdető rendszer - Linkkatalógus - Cégkatalógus - Egyedi fejlesztés www.idreampage.com/honlap-weboldal -keszites
A hirdetés részletei >>


Feladva: 2015-05-08 19:36:12    

Felni és egyébb fémtárgyak csiszolása,polírozása,cizellálása,j avítása,fényezése.
A hirdetés részletei >>


Feladva: 2018-07-15 20:55:27    

Címkék, kulcsszavak: Polírozáscsiszolásfelniautócizellálásfém

A nehéz helyzetben lévők helyzetének javítása érdekében vagy a bank elutasította, úgy döntöttem, hogy segítek nekik nekik hosszú távú finanszírozást, így ha szükségük lenne, ne habozzon lépjen velem kapcsolatba további információkért forduljon hozzánk bizalommal a kölcsönökért: E-mail: marialopezmaria289@gmail.co m WhatsApp: +33 644 680 218 Viber: +33 644 680 218
A hirdetés részletei >>


Feladva: 2018-07-15 20:14:40    

Címkék, kulcsszavak: +33 644 680 218

LG MOSÓGÉPSZERELŐ T:06/30/944-73-83 LG MOSÓGÉPSZERELÉS Dormán László lg mosógépszerelõ vállalja Whirpool Ignis Polar Energomat Minimat Midimat Energolux LG Zanussi NDK-s WA tipusú stb automata mosógépek javítását. LG MOSÓGÉPSZERELÕ KISPESTEN a kerületben lakóknak mosógépszerelés munkanapokon 4 órán belül is lehetséges. Mosógépszerelés:Erzsébet, Kõbánya, Pestlõrinc, Pestimre, Csepel, Soroksár, Ferencváros, Józsefváros, Kispest, és a XVII. k-ben. http://www.lg-mosogepszerelo.hu ... további részletek >>


Feladva: 2018-07-15 13:00:07    

Címkék, kulcsszavak: Lg mosógépszerelőmosógépszerelésmosógép szerelőmosógépjavítás

Kedves leendő munkatársam! Amennyiben olyan vagy, mint én, akkor átkutattad már az internetet, és rengeteg időt és pénzt vesztettél el a ”gyors gazdagodást”ígérő vállalkozásokkal, amelyekről kiderült, hogy átverős rendszerek. Mindig is szerettem volna elindítani a saját törvényes és megbízható üzletemet! Nos, én már meg tettem! Hivatalosan elindítottam saját otthoni vállalkozásomat, mint az SFI (Strong Future International) leányvállalatát. Íme néhány oka annak, hogy miért döntöttem ... további részletek >>

úgy, hogy az SFI-vel megyek tovább: * Az anyavállalat 1985 óta létezik. * Ingyenesen elkezdhető * Világszerte több mint 200 országban vannak jelen. * Mindent megtehetsz otthonról a számítógépeden. * 24 órás támogatás. * Ingyenes képzés és ingyenes weboldal. * Gyorsan növekszik, és nem sok pénzre van szükség, az első hónap teljesen ingyen van. A későbbiekben az elszántságtól és a szorgalomtól függ, szükséges-e befektetni, ha igen, már 29$ elég. A továbbiakban a jutalékból vissza tudjuk forgatni . A hagyományos vállalkozásokhoz legtöbbször milliók, akár tízmilliók szükségesek. Az-az első 1 hónap elég ahhoz, hogy kiismerd a lehetőségeket (6féle) és eldöntsd, hogy akarod-e tovább csinálni. Nincs semmi veszíteni való, és itt mindent,megszerezhetsz, beleértve több időt a családdal és több pénzt a pénztárcába. Érdemes megnézni az SFI-t és befektetni a jövőbe velünk. További információ e-mailben.


Feladva: 2018-07-15 12:06:46    

Neked készült az egyik legérdekesebb dolog olyan, amit mindig szerettél volna! ingyenes társkereső oldal. www.felszedlek.hu
A hirdetés részletei >>


Feladva: 2018-07-15 00:05:01    

KÁVÉRA FEL! Ha nem akar lemondani a kávézás öröméről, de az egészségére is szeretne odafigyelni, igyon jótékony hatású ganodermás kávét. A ganodermás kávé semlegesíti a szervezet által felhalmozott savakat, fogyasztásával megszüntethető a gyomorégés. Rendszeres és kizárólagos fogyasztása esetén bizonyosan megtapasztalja a gomba jótékony hatását! Amennyiben szeretne még többet megtudni a ganoderma jótékony hatásáról illetve az ezt tartalmazó termékekről látogasson el honlapunkra: ... további részletek >>


Feladva: 2018-07-14 14:00:04    

Figyelem! Munkatársakat keresek egy nemzetközi komoly céghez, hosszú távú munkára. Ha szorgalmas vagy, akarsz dolgozni és el tudsz köteleződni egy olyan céghez,ami Neked folyamatos képzést ad,és garanciát 25 évre a havi passzív keresetedre euróban ami örökölhető, akkor keress meg.Csak rajtad múlik mennyit keresel havonta, 20 eurót, vagy több ezret.Ha megkeresel elárulom hogyan.Feltétel: legyen géped, azon skype
A hirdetés részletei >>


Feladva: 2018-07-14 12:20:44    

Figyelem! Munkatársakat keresek egy nemzetközi komoly céghez, hosszú távú munkára. Ha szorgalmas vagy, akarsz dolgozni és el tudsz köteleződni egy olyan céghez,ami Neked folyamatos képzést ad,és garanciát 25 évre a havi passzív keresetedre euróban ami örökölhető, akkor keress meg.Csak rajtad múlik mennyit keresel havonta, 20 eurót, vagy több ezret.Ha megkeresel elárulom hogyan.Feltétel: legyen géped, azon skype
A hirdetés részletei >>


Feladva: 2018-07-14 12:17:18    

Választhatsz vásárlási utalványaink közül, melyek teljes vásárlási értékét a felhasználási szabályzatban leírtak szerint 100%-ban levásárolhatod a társaság e -commerce platformján, a DealKodexen, ahol 3 iparági óriás, az Ebay, a Groupon és az Amazon üzleti siker elemeit ötvözi egy platformon. Ahol rengeteg partner számtalan terméke és szolgáltatása vár rád.
A hirdetés részletei >>


Feladva: 2018-07-14 11:54:12    

Címkék, kulcsszavak: freedomDealKodex

Választhatsz vásárlási utalványaink közül, melyek teljes vásárlási értékét a felhasználási szabályzatban leírtak szerint 100%-ban levásárolhatod a társaság e -commerce platformján, a DealKodexen, ahol 3 iparági óriás, az Ebay, a Groupon és az Amazon üzleti siker elemeit ötvözi egy platformon. Ahol rengeteg partner számtalan terméke és szolgáltatása vár rád.
A hirdetés részletei >>


Feladva: 2018-07-14 11:52:47    

Címkék, kulcsszavak: freedomDealKodex

Csatlakozzon a FreedomXpress közösséghez, és nézze meg, hogyan szerezheti meg az élethosszig tartó utalványokat a vállalat globális forgalmából! Keresel valamit? Bármi is lehet, megtalálja itt! Exclusive értékesítési mindennapi! Csak a FreedomXpress közösség tagjai számára! Exkluzív értékesítés a DealKodex-on, ahol számos partner vár Önre számos partnerrel!
A hirdetés részletei >>


Feladva: 2018-07-14 11:45:18    

Címkék, kulcsszavak: freedomDealKodex

Csatlakozzon a FreedomXpress közösséghez, és nézze meg, hogyan szerezheti meg az élethosszig tartó utalványokat a vállalat globális forgalmából! Keresel valamit? Bármi is lehet, megtalálja itt! Exclusive értékesítési mindennapi! Csak a FreedomXpress közösség tagjai számára! Exkluzív értékesítés a DealKodex-on, ahol számos partner vár Önre számos partnerrel!
A hirdetés részletei >>


Feladva: 2018-07-14 11:41:32    

Csatlakozzon a FreedomXpress közösséghez, és nézze meg, hogyan szerezheti meg az élethosszig tartó utalványokat a vállalat globális forgalmából! Keresel valamit? Bármi is lehet, megtalálja itt! Exclusive értékesítési mindennapi! Csak a FreedomXpress közösség tagjai számára! Exkluzív értékesítés a DealKodex-on, ahol számos partner vár Önre számos partnerrel!
A hirdetés részletei >>


Feladva: 2018-07-14 11:39:46    

Címkék, kulcsszavak: freedomDealKodex

Lendítsd be az Üzleted Most! Részesedj te is a FreedomXpress multi milliárd dolláros iparágakat egyesítő platformjából! Ez egy egyszer az életben adódó lehetőség, ragadd, meg és ne engedd el! Ismerd meg azt az újgenerációs törzsvásárlói rendszert, ami életed végéig pénzt hoz.
A hirdetés részletei >>


Feladva: 2018-07-14 11:35:41    

Címkék, kulcsszavak: freedomDealKodex

Lendítsd be az Üzleted Most! Részesedj te is a FreedomXpress multi milliárd dolláros iparágakat egyesítő platformjából! Ez egy egyszer az életben adódó lehetőség, ragadd, meg és ne engedd el! Ismerd meg azt az újgenerációs törzsvásárlói rendszert, ami életed végéig pénzt hoz.
A hirdetés részletei >>


Feladva: 2018-07-14 11:33:18    

Címkék, kulcsszavak: freedomDealKodex

Bármilyen típusó autóját megveszem adás-vételivel!!Lehet idős,normál,elhanyagolt azonnal készpénzzel fizetek,korrekt ajánlatott teszek!!Hivjon bizalommal!!+36204378010
A hirdetés részletei >>


Feladva: 2018-07-14 11:12:24    

Magyarországon, Zala megyébenLenti kistérségében Lovászi külterületén, csendes nyugodt zöldövezetben 80 m2-es családi ház nagy és gondozott 7200 m2-es telekkel (a ház 809m2-es területen van külön helyrajzi számmal)vagy telek nélkül eladó.A házhoz több melléképület is tartozik. A ház jó állapotú, száraz, teljesen berendezett így azonnal költözhető. Vendégháznak is ajánlatos. A zalai dombságban domboldali részen erdőközeli környezetben található. Vezetékes víz, villany van, valamint minden ... további részletek >>

helyiség kandallóval felszerelt. A telek gyümölcsfákkal beültetve, de gazdálkodási célra valamint állattartásra is és lovardának alkalmas. A külterületi elhelyezkedése ellenére aszfaltos úton megközelíthető. Lovászi az ország nyugati részén fekvő település, óvoda, iskola, szabadtéri fürdő, éttermek valamint üzletek mind megtalalhatók. A 8 km-re lévő Lenti termálfürdő autóbusszal is jól megközelíthető. Az M7-es autópályától 15 perc.Közel van a szlovén és a horvát határ.Amennyiben felkeltette a hirdetésem az érdeklődését, további információkért, részletekért várom hívását Az ár alkuképes.Vezetékes telefonszán: 3692376583


Feladva: 2018-07-14 09:16:12    

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:49:52    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:49:04    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:48:27    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:47:59    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:47:27    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:47:03    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:46:43    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:46:21    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:39:20    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:38:58    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:38:38    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-14 05:38:17    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

Választhatsz vásárlási utalványaink közül, melyek teljes vásárlási értékét a felhasználási szabályzatban leírtak szerint 100%-ban levásárolhatod a társaság e -commerce platformján, a DealKodexen, ahol 3 iparági óriás, az Ebay, a Groupon és az Amazon üzleti siker elemeit ötvözi egy platformon. Ahol rengeteg partner számtalan terméke és szolgáltatása vár rád.
A hirdetés részletei >>


Feladva: 2018-07-13 11:53:34    

Címkék, kulcsszavak: freedomDealKodex

Választhatsz vásárlási utalványaink közül, melyek teljes vásárlási értékét a felhasználási szabályzatban leírtak szerint 100%-ban levásárolhatod a társaság e -commerce platformján, a DealKodexen, ahol 3 iparági óriás, az Ebay, a Groupon és az Amazon üzleti siker elemeit ötvözi egy platformon. Ahol rengeteg partner számtalan terméke és szolgáltatása vár rád.
A hirdetés részletei >>


Feladva: 2018-07-13 11:53:29    

Címkék, kulcsszavak: freedomDealKodex

Választhatsz vásárlási utalványaink közül, melyek teljes vásárlási értékét a felhasználási szabályzatban leírtak szerint 100%-ban levásárolhatod a társaság e -commerce platformján, a DealKodexen, ahol 3 iparági óriás, az Ebay, a Groupon és az Amazon üzleti siker elemeit ötvözi egy platformon. Ahol rengeteg partner számtalan terméke és szolgáltatása vár rád.
A hirdetés részletei >>


Feladva: 2018-07-13 11:51:08    

Címkék, kulcsszavak: freedomDealKodex

Légy az elsők között, használd ki a FreedomXpress prelaunch időszak soha vissza nem térő lehetőségeit és promóciós előnyeit, használd ki a prelaunch időszak alatti extra magas kifizetési tervet és lépj be a milliomosok klubjába! Most 70% Prelaunch Bónusz! Ország vezetőket keresünk! Lépjen kapcsolatba velünk
A hirdetés részletei >>


Feladva: 2018-07-13 11:43:25    

Címkék, kulcsszavak: freedomDealKodex

Pécsett az Egyetemekhez közel, négyemeletes panelben az első emeleten egy 2 szobás teljesen felújított lakás. A víz és elektromos hálózat, konyha (új konyhabútor+gépek), fürdőszoba ( új szaniterek) valamint az összes hideg és meleg burkolat cserélve lett. Az előszobában és az egyik szobában, méretre készített beépített szekrények találhatók. Ára.15.600.000,-Ft
A hirdetés részletei >>


Feladva: 2018-07-13 08:13:42    

Az iparág #1 számú üzletépítő eszköz csomagja, amely most fel fogja turbózni az üzletedet... Automatizált vevőszerző rendszer bármilyen online üzlethez. Ismerd meg,hogyan teheted egyszerűbbé és sikeressé az online üzleted egy automata vevőszerző rendszerrel. A rendszer tovább ajánlásával pénzt is kereshetsz. Fizetés hetente dollárban. Kattints az alábbi linkre, s kérd a videó összefoglalót https://tinyurl.hu/q8A1/
A hirdetés részletei >>


Feladva: 2018-07-12 22:22:13    

Szoktál-e pénzt kapni attól az áruháztól, ahol a termékeket vásárolod (üzletekben,gyógyszertárban, drogériákban)? Érdekelne egy olyan cég, amely fizet azért,hogy nála vásárolsz és megmutatod másoknak, hogyan tudnak ők is hozzájutni saját webáruházukhoz a termékekhez nagyon kedvező áron? Saját ingyenes webáruházadban nem csak vásárolhatsz több mint 300 biotermék közül, hanem a közreműködéseddel tovább ajánlásoddal számodra hosszú távú, folyamatos bevételi forrássá válik. Minden vásárlásból ... további részletek >>

levásárolható bónuszokat is és pénz jóváírást kapsz.Rengeteg folyamatos kedvezményt is vár rád minden hónapban Jogdíjas passzív jövedelem amit később átadhatod a gyermekednek és tovább tudja vinni vállalkozásodat! magas jutalék autóprogram szintbónuszok előrelépési lehetőség. Vedd fel velem a kapcsolatot,hogy segíthessek az elindulásban és Mielőtt vásárolnál a saját fiókodban a regisztráció után,hogy az ajándékodat is megkaphasd! Regisztrációs link:https://www.life-care.com/Interfaces/PartnerRegister.aspx?parentCode=648149&isMandatory=true&ctryCode=HU Regisztrálj partnerként és a katalógus árhoz képest már azonnal 20% kedvezménnyel vásárolhass magadnak. Katalógus linkje:http://catalog.life-care.com/2018/HU/catalog_HU2018_1HU/


Feladva: 2018-07-12 18:39:01    

Ha eleged van az ígéretekből és szeretnél pénzt keresni egy megbízható cégnél , akkor ezt megteheted, ha ezért képes vagy tenni is, ahol a regisztráció ésa verifikáció ingyenes: http://www.likesxlxpro.nhely.hu/ Bármi kérdésed van keress email-ben: csaba.kery70@gmail.com
A hirdetés részletei >>


Feladva: 2018-07-12 13:09:51    

Címkék, kulcsszavak: likesxlpasszív jövedelemmellékállásplussz jövedelemdigitális valutatávmunkaalkalmi állás

Minőségi, gyors Költöztetés Budapesten, átlátható és bárki számára megfizethető áron https://koltoztetunk.com/ Cégünk rugalmasan és magas színvonallal biztosítja a Költöztetés Budapesten szolgáltatását. Vállalkozásunk teljes mértékben arra törekedett hogy megkönnyítse az ügyfelek stresszes és fáradságos költözését, megbízható és korrekt partnert találjanak a bútorzatuk, értékeik, használati dolgaik, személyes tárgyaik szállítására, költöztetésére. Amit biztosítani tudunk: költöztető ... további részletek >>

dobozok ✔ több méretű, korszerű tehergépjármű ✔ gyakorlott, megbízható szállítómunkások ✔ bútorok szerelése pluszköltség nélkül ✔ hétvégén, ünnepnap normál díjszabás ✔ nincs km díj, emelet díj és hétvégi felár ✔ több teherautóval rendelkezünk ✔ Budapesten díjmentes előzetes munkafelmérés ✔ könnyen átlátható, megfizethető díjszabás számlaképes, utolérhető vállalkozás vagyunk ✔


Feladva: 2018-07-12 10:11:39    

Címkék, kulcsszavak: költöztetésköltöztetés olcsónköltöztetés budapestköltöztetés árak

FIAMNAK LÁNYT KERESEK SZERELMES LÁNY SZOBATÁRSAT KERESEK NAGY FIAMNAK AKI 31 ÉVES MÚLT ÉS MÉG NEM VOLT BARÁTNŐJE. HOZZÁNK KÖLTÖZHETNÉL ÉN IS OTT LAKNÁK VELETEK 43 m2 LAKÁSBAN CSAK EGY FŐT TUDUNK FOGADNI VAGYIS GYERMEK HÁZIÁLLAT NEM HOZHATÓ A LAKÁSBA MIVEL CSAK EGY SZOBA VAN. FIAM MÁR SOK HIRDETÉST FELADOT DE NEM SÍKERÜLT NEKI ÉS MEGKÉRT ÉN KERESEK LÁNYT NEKI. OLYAN LÁNY KÉNE NEKI AKI SZENVEDÉLYESEN SZERETI ŐT ÉS KEZDEMÉNYEZŐ. 18 ÉVES KORTÓL 31 ÉVES KORIG KERESEK LÁNYT FIAMNAK EMAIL: ... további részletek >>


Feladva: 2018-07-12 09:08:42    

A már jól ismert, bevált, és előnyös tulajdonságaival bizonyított OSB lapok mellett 2006-ban megkezdtük a hasonló felhasználási területű, de költséghatékonyabb – olcsóbb – megoldást nyújtó MFP lapok forgalmazását is. Mindkét termékcsoport különböző vastagságban (az MFP nútféderes változatban is) megvásárolható telepi készletünkből. Az MFP lap is rendelkezik magyar ÉMI típusvizsgálati bizonyítvánnyal, hosszanti és keresztirányú szilárdsági értékei könnyedén teljesítik az OSB/3 ... további részletek >>

EN300-as követelményeit. MFP lapok - Árvai Fatelep MályiAz MFP lapok főbb jellemzői: - jól terhelhető - stabilitást nyújt - ellenáll a nedvességnek - megmunkálás és külső megjelenés szempontjából a masszív fához hasonló Az MFP lapok felhasználási területei: - padlókészítés - falborítás - tetőfedés - építési kerítések - csomagolások - fakeret szerkezet borításra a DTU 31.2 szerint engedélyezve - zsaluzatok - faházépítés Kérjen személyre szabott árajánlatot! http://arvaifa.hu/termekek/mfp-es-osb-lapok/


Feladva: 2018-07-12 08:06:59    

Svájcban igényes lányok-hölgyek jelentkezését várjuk 20 éve működő bárba, akik szeretik a pörgést és a sok vendéget és a sok pénzt. Tisztán 3000-6000 frank közötti összeg megkereshető! Nyelvtudás nem kötelező, recepciós segíti a munkádat. A kereset kimagasló, nincsen semmilyen kiadásod, költséged, minden biztosítva van számodra, ami a munkához szükséges! Jelentkezés: +36-70-275-7343 Mobilon , Viberen Email: er otikeu@gmail.com
A hirdetés részletei >>


Feladva: 2018-07-12 01:15:14    

Az iparág #1 számú üzletépítő eszköz csomagja, amely most fel fogja turbózni az üzletedet... Automatizált vevőszerző rendszer bármilyen online üzlethez. Ismerd meg,hogyan teheted egyszerűbbé és sikeressé az online üzleted egy automata vevőszerző rendszerrel. A rendszer tovább ajánlásával pénzt is kereshetsz. Fizetés hetente dollárban. Kattints az alábbi linkre, s kérd a videó összefoglalót https://tinyurl.hu/q8A1/
A hirdetés részletei >>


Feladva: 2018-07-11 23:10:49    

Címkék, kulcsszavak: üzletépítő eszköz csomagautomatizált

Munkáim egyik fő tevékenységi köre! GYORS SZOLGÁLAT, ha megoldható, akár hétvégén is! CSÕTÖRÉS, BEÁZÁS utáni KÕMÛVES, BURKOLÓ javítási munkák,”kis munkák” vakolat illetve egyéb javítási munkák. Burkolatok fali csempék, járólapok cseréjét, pótlását.”kis munka”. A javítási munkáimat, hagyományos módon készítem el, helyszínen kevert habarcsból simított kivitelben. Kérem a javítandó munkáról küldjön 1 db teljes képet. Mindig csak egy telefonhívásra vagyok ... további részletek >>

Öntől! Ha segítségre van szüksége, hívjon bizalommal. „kis munka” Kivitelezés helyszínére szabott megfizethető árak. Rikk-szaki: 06-20/915-8893


Feladva: 2018-07-11 15:29:55    

Címkék, kulcsszavak: Kisebb nagyobb kőműves javításokkis munkák

Miskolcon, közműves építési telek tulajdonostól eladó. Alattunk sarokház, felettünk is szép családi ház. Ebben az utcában csak ez a telek szabad, Borostyán u.14. Az új, kényelmes házát a felső szomszéd telekhatárára építheti. Előny: jó szomszédok, aszfaltozott járda és közút, 11-es buszmegálló 3 percre, gáz, víz, csatorna a telken, villanyoszlop a kapu előtt, a telek körbe van kerítve. Déli fekvésű 986 nm-es kellemes, meleg, szélvédett terület. A képen látható diófát kivágatom ... további részletek >>

gyökerestül, ha a házát oda képzelte. A belváros autóval vagy busszal pár perc alatt elérhető. Ne gondolkodjon sokat, hívjon most: 06-20-560 7834 vagy 06-48-318 223 telefonon! Megbeszéljük a részleteket. E-mai-re válaszolok. Üdvözlettel: Mohos Gáborné


Feladva: 2018-07-11 14:25:50    

Címkék, kulcsszavak: telekközműves teleképítési telek Miskolc

NÉMET MUNKA –folyamatosan 45-60 db állásunk van. A bért mindig kiírjuk. Szállás mindig van. Részletek a következő linkekre kattintva olvashatóak: http://www.nemetmunka.hu/allasaink.html és http://www.nemetmunka.hu/vendeglatos-munka.html MAI állásajánlatunk: Nr.177 Rasthof kiszolgáló német állás Heilbronn, Stuttgart, Frankfurt és még további 17 helyen. A német autópályákon 20 helyen lévő autópálya pihenőkbe, Rasthaus-ba keresünk szimpatikus női és férfi kiszolgáló személyzetet. ... további részletek >>

Felszolgálói végzettség nem kell, de a jó némettudás (B1-től) szükséges. A német munkahely dolgozóinak a feladata az önkiszolgáló étteremben, kávézóban és a pultnál történő kiszolgálás és a kasszánál történő munkavégzés. Változó munkarend van. A munkahét 5 napos, 173 óra / hónap. A fizetés 1.557€-tól bruttó plusz a pótlékok. (délutáni, éjszakai, hétvégi, stb ami nettó 1200-1400€-ra jön ki. Étkezés személyzeti áron, (50% kedvezmény) Szállás 150€/hónap vagy egyéni megegyezés szerint. Minden állásunk betöltésével német nyelvű munkaszerződést kap a dolgozó, amely megértésében, átbeszélésében igény szerint szívesen segítünk. Hosszútávú munkát keresőkre számítunk. A munkaközvetítésért vagy egyéb másért fizetni, ill. bármit aláírni nem kell! Jelentkezni lehet (e-mailben, regisztrálással vagy telefonon): 1.) E-mailben: info@nemetmunka.hu (telefonszám megadásával) 2.) Ingyenes regisztrációval a következő linkre kattintva: http://www.nemetmunka.hu/regisztracio-nemetorszagi-munkavegzesre.html 3.) Telefonon hétfőtől-péntekig a magyar 06 1 920 3433, ill. a német 0049 8641 6949 000 vezetékes számokon (hétfőtől péntekig 9.00-15.00-ig). Josef Kling EXACT Personal UG 83224.Grassau (német munkaközvetítő cég Bajorországban) Cégjegyzék száma: HRB 25122 Traunstein (közvetítési vagy egyéb díj nincs) www.nemetmunka.hu


Feladva: 2018-07-11 13:45:30    

Címkék, kulcsszavak: németmunkanémetmunkaállásmunkahely

Egyedi tervezésű és gyártású, folyamatos munkavégre kialakított komplex, bárhova integrálható munkaállomás. Az alkatrészek hidegbarnítása, felületkezelése korrózió-védelem céljából használatos. Szép, tartós, homogén felületet képezve az az acél alkatrészek felületén. Ajánlott kis szériás alkatrészgyártó illetve gépépítő cégeknek. A barnítás folyamata nem több mint 30 perc. A hidegbarnító konveyor rendszer a legoptimálisabb és leghatékonyabb munkavégzésre lett tervezve. A kilenc darab ... további részletek >>

görgőpályán mozgatható függesztéknek köszönhetően az egyes folyamatok, fázisok egymással párhuzamosan, egy időben történhetnek, így biztosítva a folyamatos termelést. Erős, masszív vázszerkezettel, festett illetve felületkezelt egységekkel. Standard függesztékekkel és ömlesztett áru fogadására képes merítő kosarakkal. A rendszer moduláris felépítésű, egyszerűen szétszerelhető és áttelepíthető emberi erővel. Gép tartozékai: - (A komplett rendszer, vegyszerekkel, kiegészítők nélkül) - Komplett vázszerkezet, felső görgőpálya, görgőrendszer - Függesztékek, (9db) kosarakkal - 50 L-es kádak, ( 7db) tetővel - Összeszerelési utasítás, gépkönyv - Technológia leírás Ára (használt):600 000 HUF+ÁFA


Feladva: 2018-07-11 09:17:07    

Keres egy üzleti hitel? Személyi hitel, diákhitel, diákhitel, diákhitel, adósság konszolidációs hitelt, fedezetlen hitel, kockázati tőke, stb ha igen írj nekünk ma: (dakany.endre@gmail.com) és kap a hitel Ma. Sürgős kölcsön ajánlat.
A hirdetés részletei >>


Feladva: 2018-07-11 08:28:23    

Címkék, kulcsszavak: Hitel ajánlat.

Szüksége van egy hitelre a számlák megfizetésére vagy egy új vállalkozás megkezdésére? további információért forduljon hozzám. harrybale699@gmail.com
A hirdetés részletei >>


Feladva: 2018-07-11 08:24:27    

Szeretettel várom Önöket kedvenceikkel együtt szalonjaimban :1131.Bp.XIII.ker.Vőlegény u.3/b. valamint 1039.Bp.III.ker. Hadrianus u.5 előzetes bejelentkezés alapján:hétfő-péntek:12:00-23:45-ig .m:+36-70-533-7714 Amit nyújtani tudok:bontás, nyírás, különböző standard,vagy egyedi fazonok kialakítása.Egyénre szabott termékek használata. honlap: http://allatiszepseg.hupont.hu /
A hirdetés részletei >>


Feladva: 2018-07-10 18:19:57    

Automatizált vevőszerző rendszer bármilyen online üzlethez. Ismerd meg,hogyan teheted egyszerűbbé és sikeressé az online üzleted egy automata vevőszerző rendszerrel. A rendszer tovább ajánlásával pénzt is kereshetsz. Fizetés hetente dollárban. Kattints az alábbi linkre, s kérd a videó összefoglalót https://tinyurl.hu/q8A1/
A hirdetés részletei >>


Feladva: 2018-07-10 15:47:59    

Automatizált vevőszerző rendszer bármilyen online üzlethez. Ismerd meg,hogyan teheted egyszerűbbé és sikeressé az online üzleted egy automata vevőszerző rendszerrel. A rendszer tovább ajánlásával pénzt is kereshetsz. Fizetés hetente dollárban. Kattints az alábbi linkre, s kérd a videó összefoglalót https://tinyurl.hu/q8A1/
A hirdetés részletei >>


Feladva: 2018-07-10 15:35:41    

Címkék, kulcsszavak: automatizáltvevőszerzőrendszer

SOS tetök javitása szigetelése bádogozása régitetök átrakása palatető szigetelése bontâsa zsindelytető épîtése javitâsa ,tetőszerlezet épitése javitása,.Tetők épîtése, bádogozás,lapostető szigetelés.javitása, terasz.erkély előtető épîtése, kêmények szigetelése bélelése javitása épitése bontása egyebek. Tetők átvizsgálása téliesitêse hő szigetelêse, lakások házak hő szigetelése hang szigetelése,házak pincék viz szigetelését. Nyaralok faházak egyebek téliesitése.lakás átalakitás á ... további részletek >>

tol z ig,.biztositási kár felmêrésIngyenes anyagbeszerzés Rugmas munkakezdês, Szolid átalakitás, Hosszutávu garanciállis kivitelezé s, SOS tetőjavitó szolgálat hétvégên is www.tetofedesszigeteles.5mp.eu


Feladva: 2018-07-10 12:07:35    

Címkék, kulcsszavak: Tető átrakás.tető építés.bádogozás.palatető javítás.zsindelytető javítás.ácsmunkák.előtető építés.cserép átrakás.lapostető szigetelés.cserepeslemez rakás.hullámpala javítás.polikar

SOS tetök javitása szigetelése bádogozása régitetök átrakása palatető szigetelése bontâsa zsindelytető épîtése javitâsa ,tetőszerlezet épitése javitása,.Tetők épîtése, bádogozás,lapostető szigetelés.javitása, terasz.erkély előtető épîtése, kêmények szigetelése bélelése javitása épitése bontása egyebek. Tetők átvizsgálása téliesitêse hő szigetelêse, lakások házak hő szigetelése hang szigetelése,házak pincék viz szigetelését. Nyaralok faházak egyebek téliesitése.lakás átalakitás á ... további részletek >>

tol z ig,.biztositási kár felmêrésIngyenes anyagbeszerzés Rugmas munkakezdês, Szolid átalakitás, Hosszutávu garanciállis kivitelezé s, SOS tetőjavitó szolgálat hétvégên is www.tetofedesszigeteles.5mp.eu


Feladva: 2018-07-10 12:00:17    

Címkék, kulcsszavak: Tető átrakás.tető építés.bádogozás.palatető javítás.zsindelytető javítás.ácsmunkák.előtető építés.cserép átrakás.lapostető szigetelés.cserepeslemez rakás.hullámpala javítás.polikar

Eladó csere miatt egy gáz-benzin üzemü 2005 ös évjáratú Nissan Almera jól felszerelt kitünő műszaki állapotú személygépkocsi tulajdonostól.
A hirdetés részletei >>


Feladva: 2018-07-10 09:53:11    

Címkék, kulcsszavak: gáz megkímélt nissan

SOS tetök javitása szigetelése bádogozása régitetök átrakása palatető szigetelése bontâsa zsindelytető épîtése javitâsa ,tetőszerlezet épitése javitása,.Tetők épîtése, bádogozás,lapostető szigetelés.javitása, terasz.erkély előtető épîtése, kêmények szigetelése bélelése javitása épitése bontása egyebek. Tetők átvizsgálása téliesitêse hő szigetelêse, lakások házak hő szigetelése hang szigetelése,házak pincék viz szigetelését. Nyaralok faházak egyebek téliesitése.lakás átalakitás á ... további részletek >>

tol z ig,.biztositási kár felmêrésIngyenes anyagbeszerzés Rugmas munkakezdês, Szolid átalakitás, Hosszutávu garanciállis kivitelezé s, SOS tetőjavitó szolgálat hétvégên is www.tetofedesszigeteles.5mp.eu


Feladva: 2018-07-10 07:18:58    

Címkék, kulcsszavak: Tetőfedő.ács.bádogos.hő szigetelő.kémény.előtető.lapostető szigetelő.tetőbeázás javìtás.palatető .zsindejtető.cseréptető.tető átrakás.bádogos.polikarbonát szerelő.homlogzat szigete

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:26:53    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:26:30    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:26:07    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:25:08    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:24:44    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:24:17    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:23:52    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:23:22    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:22:55    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:22:31    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:22:11    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-10 06:21:50    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

Az árakat tekintve nem bánja meg kategória! Pest megyéből Liszt Ferenc reptéri taxi személyszállítás. Olcsóbban, mint a mai budapesti taxi árak.Pest megyei transzferek Abony, Aszód, Budakeszi, Budaörs, Cegléd, Dabas, Dorog, Dunakeszi, Ercsi, Farmos, Gödöllő, Gyömrő, Nagykáta, Nagymaros, Nagytarcsa, Szentendre, Szentmártonkáta, Szigetszentmiklós, Tököl, Tura, Tahitótfalu, Sülysáp, Vác, Vácrátót, Visegrád körzetekből.
A hirdetés részletei >>


Feladva: 2018-07-09 23:07:07    

Címkék, kulcsszavak: taxireptértranszferpestmegye

Hurrá,megtaláltam NEKEM SIKERÜLT! A SFI üzlet egy sikeres, reklámozással foglalkozó vállalkozás,Komoly, dolgozni akaró emberek munkája! Ha nekem sikerült Neked miért ne sikerülne? Megmutassam neked, hogy én hogy csináltam? Ilyen csak a MESÉBEN van,és a SFI vállalkozásnál. Ingyen regisztrálhatsz, akkor dolgozol amikor neked jó,és itt semmi nem kötelező!Te döntesz mindenben, abban is, hogy mit reklámozol ?Téged is érdekel? Írj üzenetet, és küldöm az infót!
A hirdetés részletei >>


Feladva: 2018-07-09 20:05:44    

A F1 magyar nagydíjra keresek vendéglátásban jártas munkatársakat, pultos, grilles,gyrosos munkakörökbe, alap idegen nyelv ismerettel, valamint Konyhai kisegítő és pakolós feladatokra. Kiemelt fizetés, napi étkezés. Jelentkezni a 06702578519 számon, vagy e-mailen lehet.
A hirdetés részletei >>


Feladva: 2018-07-09 19:49:42    

Keress dollárt hetente! Egy eszköz – számtalan lehetőséggel! Automatizáld a pénzszerzést! Megtanítunk rá úgy, hogy külön ne fizess érte! Infó a linken: https://goo.gl/naxqnX
A hirdetés részletei >>


Feladva: 2018-07-09 18:37:01    

Felkapott üdülőhellyé nőtte ki magát a Dunaszekcsői téglagyári víkend telep. Kedvelt nyári pihenőhely első osztályú homokos part, sekély vizű strand vonzza ide a látogatókat. Itt kínálunk eladásra egy kétszintes 56 nm-es hétvégi házat, nagy légtérrel s nagy hasznosítási lehetőséggel. Az Aréna vendéglő közelsége mellett a Dunai panoráma és a tiszta Dunai levegő, a horgászás, s a kellemes strandolási lehetőség miatt érdemes megfontolni ajánlatunkat. A lakótérbe egy nagy teraszon keresztül tudunk ... további részletek >>

belépni ahol azonnal a nappaliba jutunk, innen a boltívvel elválasztott főzőfülke, kamra, fürdőszoba és az emeletre vezető falépcső mutatkozik. Fenn az emeleten két szőnyegpadlós szoba, s az erkély található.


Feladva: 2018-07-09 18:06:23    

A legolcsóbb jó minőségű gabionkosarak és alkotóelemeik a piacon. Termékeink hegesztett rácsból készülnek. Az Aluminium -cink bevonatú drót vastagsága 4 mm A bevonat vastagsága 260 g/m2 A gyártási kapacitásunk korlátlan mennyiségű. Mivel az egész árlistánk a hirdetésben nem jeleníthető meg azt e-mail ban tudjuk Önnek elküldeni. Cégünk Felvidéken,Dunaszerdahelyen található. Magyarul beszélünk. r amol@ramolstone.sk www.gabionkerítések.eu 00421905302256
A hirdetés részletei >>


Feladva: 2018-07-09 14:58:59    

Címkék, kulcsszavak: gabiongabionokkerítéstámfallábazat

A fogszabályozás az Ön számára egy kiváló lehetőséget jelent fogai egészségének hosszú távú megőrzésére és szabályosabbá, szebbé és természetesebbé tételére.Jöjjön el rendelőnkbe és ismerkedjen meg a modern fogszabályozás kíméletes módszereivel, melyekkel látványos eredményeket tudunk közösen elérni. https://fogszabalyozascentrum.hu/
A hirdetés részletei >>


Feladva: 2018-07-09 14:24:09    

Címkék, kulcsszavak: fogszabályozásfogszabályozás Budapestfogszabályozás CentrumMODERN FOGSZABÁLYOZÓ KÉSZÜLÉKEKLágy erővel működő fogszabályzóEsztétikus fogszabályozásfájdalommentes fogsza

Túlméretes gépjárművek kíséretéhez gépjárművezetőt keresünk. A munkavégzés zárt furgonokkal történik, többnyire éjjel, az országon belül tranzit viszonylatban. Esténként 700-800 km, egy hónapban kb. 10000 km. ”C” kategóriás jogosítvány feltétel. Jelentkezés e-mailben, a fizetési igény megjelölésével.
A hirdetés részletei >>


Feladva: 2018-07-09 13:18:30    

epoxi asztalok és felületek gyártása.
A hirdetés részletei >>


Feladva: 2018-07-09 11:20:37    

Címkék, kulcsszavak: epoxy tbleepoxi asztal

IH Direkt Gmbh. Allasajanlat Segedmunka / minösegellenör Foglalkoztatas: teljes munkaidö, 4 müszak ( müszakbeosztas egesz evre elöre megadva ) Hely: Knittlingen ( tiszta, nyugodt munkakörülmeny ) Ber: 10 € Brutto / ora + müszakpotlekok ( 25 % ejszakas potlek, 50% vasarnapi,100 % munkaszüneti nap potlek ) Feladatok A gyogyszereszetben-egeszsegügyben hasznalatos müanyag fiolak gyartasa, gyartas közi, gyartas utani ellenörzese, csomagolasa, dokumentalasa Elvarasok: Nemet nyelv beszed ... további részletek >>

iras B2 szint. Eles latas Megbizhatosag, precizitas, pontossag Amit kinalunk: IGZ/DZB tarifan felüli jövedelem, + potlekok, ( 25 % ejszakas potlek, 50% vasarnapi,100 % munkaszüneti nap potlek ) 1 adokategoriaban szamolva 1450-1600 € netto / honap kereseti lehetöseg. Szabadsag, karacsonyi penz Munkaruhazat biztositasa Kivalo munka eseten 6 maximum 8 honap utan direktatveteli lehetöseg. A direktatvetel utan oraber 11€ Brutto / ora, + 40 % ejszakas potlek , 1 adokategoriaban szamolva minimum 2000 € netto/ honap kereseti lehetöseg. Munkaidön kivüli kapcsolattartas Szallas, igenyelhetö, max. 2 fös szobakban 280 € / fö, utolag berböl levont, A szallon lako autoval nem rendelkezö dolgozoinkat igeny szerint ceges busz 50 € havidij ellenertekben szallitja munkahelyükre, es onnan vissza szallasaikra. Az allasajanlatra palyazni a következö elerhetösegen lehet: Kapcsolattarto: Anita Antal IH Direkt GmbH. Hoferstrasse 9/a D-71638 Ludwigsburg Telefon: 0 71 41 / 29958-21, +491749591797, +491757093723 Telefax: 0 71 41 / 29958-11 anita.antal@ih-direkt.de Allasajanlataink megtekinthetöek a www.ih-direkt.de weboldalon vagy a Munkalehetösegek Ludwigsburg es környeken Facebook oldalon


Feladva: 2018-07-09 10:25:29    

IH Direkt Gmbh. Allasajanlat Segedmunka / minösegellenör Foglalkoztatas: teljes munkaidö, 4 müszak ( müszakbeosztas egesz evre elöre megadva ) Hely: Knittlingen ( tiszta, nyugodt munkakörülmeny ) Ber: 10 € Brutto / ora + müszakpotlekok ( 25 % ejszakas potlek, 50% vasarnapi,100 % munkaszüneti nap potlek ) Feladatok A gyogyszereszetben-egeszsegügyben hasznalatos müanyag fiolak gyartasa, gyartas közi, gyartas utani ellenörzese, csomagolasa, dokumentalasa Elvarasok: Nemet nyelv beszed ... további részletek >>

iras B2 szint. Eles latas Megbizhatosag, precizitas, pontossag Amit kinalunk: IGZ/DZB tarifan felüli jövedelem, + potlekok, ( 25 % ejszakas potlek, 50% vasarnapi,100 % munkaszüneti nap potlek ) 1 adokategoriaban szamolva 1450-1600 € netto / honap kereseti lehetöseg. Szabadsag, karacsonyi penz Munkaruhazat biztositasa Kivalo munka eseten 6 maximum 8 honap utan direktatveteli lehetöseg. A direktatvetel utan oraber 11€ Brutto / ora, + 40 % ejszakas potlek , 1 adokategoriaban szamolva minimum 2000 € netto/ honap kereseti lehetöseg. Munkaidön kivüli kapcsolattartas Szallas, igenyelhetö, max. 2 fös szobakban 280 € / fö, utolag berböl levont, A szallon lako autoval nem rendelkezö dolgozoinkat igeny szerint ceges busz 50 € havidij ellenertekben szallitja munkahelyükre, es onnan vissza szallasaikra. Az allasajanlatra palyazni a következö elerhetösegen lehet: Kapcsolattarto: Anita Antal IH Direkt GmbH. Hoferstrasse 9/a D-71638 Ludwigsburg Telefon: 0 71 41 / 29958-21, +491749591797, +491757093723 Telefax: 0 71 41 / 29958-11 anita.antal@ih-direkt.de Allasajanlataink megtekinthetöek a www.ih-direkt.de weboldalon vagy a Munkalehetösegek Ludwigsburg es környeken Facebook oldalon


Feladva: 2018-07-09 10:15:58    

Angol online tanfolyam kezdőknek és újrakezdőknek, ha nincs időd nyelviskolába járni itt a helyed! Most 20 ingyenes ONLINE leckével próbáld ki magad és fejleszd tudásodat. Képek, videók és különböző feladatok segítenek az angol nyelv elsajátításában. Tesztek és gyakorlási lehetőség INGYEN. Tanulj otthon, a saját időbeosztásod szerint! Webcímünk: http://tanoda.shp.hu
A hirdetés részletei >>


Feladva: 2018-07-08 21:11:54    

Címkék, kulcsszavak: angol kezdőkezdő angolingyen angolonline angol

Angol online tanfolyam kezdőknek és újrakezdőknek, ha nincs időd nyelviskolába járni itt a helyed! Most 20 ingyenes ONLINE leckével próbáld ki magad és fejleszd tudásodat. Képek, videók és különböző feladatok segítenek az angol nyelv elsajátításában. Tesztek és gyakorlási lehetőség INGYEN. Tanulj otthon, a saját időbeosztásod szerint! Webcímünk: http://tanoda.shp.hu
A hirdetés részletei >>


Feladva: 2018-07-08 20:47:22    

Címkék, kulcsszavak: angol kezdőkezdő angolingyen angolonline angol

Telek ingatlantulajdonosok Figyelem! A Balaton északi partján veszprémtől 18 km-ig vállalunk kézi munkaerővel kert épitést kivitelezést egyedien nem milliokért joval árajánlat allatt...Megépitjük!!! Forduljon bizalommal hozzám!Minden további részlates megbeszélés személyesen..Aki keres talál s aki talál az sikere viszi a dolgot!!!
A hirdetés részletei >>


Feladva: 2018-07-08 15:39:01    

Címkék, kulcsszavak: nincs

Munkáim egyik fő tevékenységi köre! GYORS SZOLGÁLAT, ha megoldható, akár hétvégén is! CSÕTÖRÉS, BEÁZÁS utáni KÕMÛVES, BURKOLÓ javítási munkák,”kis munkák” vakolat illetve egyéb javítási munkák. Burkolatok fali csempék, járólapok cseréjét, pótlását.”kis munka”. A javítási munkáimat, hagyományos módon készítem el, helyszínen kevert habarcsból simított kivitelben. Kérem a javítandó munkáról küldjön 1 db teljes képet. Mindig csak egy telefonhívásra vagyok ... további részletek >>

Öntől! Ha segítségre van szüksége, hívjon bizalommal. „kis munka” Kivitelezés helyszínére szabott megfizethető árak. Rikk-szaki: 06-20/915-8893


Feladva: 2018-07-08 13:57:14    

Címkék, kulcsszavak: Kisebb nagyobb kőműves javításokkis munkák

autoval rendelkezo feseteni,glettelni tudo embert keresek.munka:8-16 oráig,napi ber:12000 plussz benzin penz.heti fizetessel holnaptol.06204576998
A hirdetés részletei >>


Feladva: 2018-07-08 10:42:31    

Ez a gabion termék magasabb minőséget képvisel az átlagnál. Nem kínai termékről van szó.Az egész termék tűzhorganyozott. A vastagsága csak 20 cm , nem foglalja el a kis telek nagy részét. A kerítés önálló egységekből tevődik össze. Minden egység 250 cm hosszú tartozik hozzá 2 acél oszlop és 2 duplán merevített tűzhorganyozott oldalháló.Nem tartalmaz további bonyolult alkatrészeket. A kívánt hosszúságot több szekció összecsatolásával tudjuk elérni. A felépítése igen egyszerű. Nem szükséges ... további részletek >>

hozzá speciális tudás. A kerítést tetszés szerinti darabos anyagokkal lehet feltölteni ez a legtöbbször egyszerű ököl nagyságú zúzott követ jelent de lehet akár kuglira vágott fa,bontott tégla,tört tetőcserép,fenyőtoboz és sok minden más is. Valójában a kerítés önhordó ha nem tölti fel semmivel akkor is ellátja a kerítés szerepét . A hirdetésben a 143 cm magas egység árát adtam meg ami 128,2 euro AFA -val. Az egész árlistát e-mail ban tudom elküldeni. Kapcsolat magyarul Dunaszerdahely tel: 00421 905 302 256 e-mail: ramol@ramolstone.sk www.gabionkeritesek.eu www.ko-burkolat.eu


Feladva: 2018-07-08 10:06:26    

Címkék, kulcsszavak: gabion kerítéskerítések

Kedves Vásárló! Nálunk a kerítés építés összes elemét megtalálhatja: Betonoszlop, drótháló, vadháló, feszítőhuzal, lábazati elem, kerítés, zsalukő, kerítés panel, csőoszlop és még sok más, amit a http://kerites.hupont.hu oldalon megtalálhat. Vállalunk az ország egész területén kerítés építést 1000/m áron Rendelését akár házhoz is szállítjuk!!! Hívjon minket bátran.
A hirdetés részletei >>


Feladva: 2018-07-08 09:53:15    

Címkék, kulcsszavak: Vadháló drótfonat kerítésdrót betonoszlop drótkerítés kerítés építés oszlop huzal drót

cannabis szó nem csak egy növényt jelez, hanem egy növénycsoport átfogó neve.,, (AMBRÓSIA).” Ennek része a cannabis sativa, azaz hasznos kender, melynek anyaga nem tartalmaz halucinogén anyagokat, nem okoz függőséget, és nincs más káros hatása sem. Azonban eredményesen alkalmazható az: Idegalapi (neurotikus) fájdalommal járó krónikus betegségek tüneteinek csillapítása (pl. sclerosis multiplex). Menstruációs görcsök,íÍzületi gyulladással járó tünetek enyhítésére, Epilepszia, és ... további részletek >>

Parkinson-kór Glukóma (zöldhályog), depresszió esetén. Enyhítheti az Ízületi gyulladás (Rheumatoid arthitis), psoriazis, egyéb bőrgyulladások tüneteit. Csillapítja a köhögést, bevethető a Dystonia (izomtónus rendellenesség), sportolás utáni izomregenerálásban, a száraz bőr kezelése. Csökkenti a koleszterinszintet, a vérnyomást és helyreállítja a vérkeringést.


Feladva: 2018-07-07 20:11:29    

Szeretnéd élvezni a napsütés más előnyeit is? Mi lenne ha PÉNZT is termelne Neked? Na van ilyen! Akár havi több ezer eurót is kereshetsz. Egy komoly napenergiával foglalkozó cég ezt lehetővé teszi számodra is. Online munkatársat keresek, havi passzív jövedelemért, amennyiben rendelkezel géppel,skype-vel és akarsz dolgozni. Jelezd ha érdekel. Sallai.belane@upcmail.hu
A hirdetés részletei >>


Feladva: 2018-07-07 16:12:59    

Címkék, kulcsszavak: eurójövedelemmunkatárs

Alacsony összeggel indítható! Életre szóló, sőt örökölhető! Rövid idő alatt havi fix jövedelem elérhető! Utazások! Céges autóhasználat! Eszköz arra, hogy az életed kezedbe tudd venni! Családi életet jobbító és átalakító rendszer! Mindenki számára! https://senoffers.com/sales/agi070 8
A hirdetés részletei >>


Feladva: 2018-07-07 15:56:08    

NÉMET MUNKA –folyamatosan 45-60 db állásunk van. A bért mindig kiírjuk. Szállás mindig van. Részletek a következő linkekre kattintva olvashatóak: http://www.nemetmunka.hu/allasaink.html és http://www.nemetmunka.hu/vendeglatos-munka.html MAI állásajánlatunk: Nr. 179-180. Felszolgáló / konyhai kisegítő páros német állás Würzburg közelében. Jó némettudással (B1-től) német felszolgáló állás 1532€ bruttó fizetésért, 40 órás munkahéttel, ingyen szállással. (ellátás nincs) Szívesen ... további részletek >>

látnak párt akkor, ha a másik személy konyhai kisegítő valamennyi némettudással. (A1-A2). A feladat a rendezvényekor az ételek előkészítése (zöldség tisztítás, salátakészítés, konyhai munkák) és a vendégek kiszolgálása. A német munkáltató egy rendezvényszervező cég, aki egy 1230 -ban épített, de teljesen felújított épületkomplexumban működik ahol céges összejövetelek, továbbképzések és lakodalmak rendezése történik. Minden állásunk betöltésével német nyelvű munkaszerződést kap a dolgozó, amely megértésében, átbeszélésében igény szerint szívesen segítünk. Hosszútávú munkát keresőkre számítunk. A munkaközvetítésért vagy egyéb másért fizetni, ill. bármit aláírni nem kell! Jelentkezni lehet (e-mailben, regisztrálással vagy telefonon): 1.) E-mailben: info@nemetmunka.hu (telefonszám megadásával) 2.) Ingyenes regisztrációval a következő linkre kattintva: http://www.nemetmunka.hu/regisztracio-nemetorszagi-munkavegzesre.html 3.) Telefonon hétfőtől-péntekig a magyar 06 1 920 3433, ill. a német 0049 8641 6949 000 vezetékes számokon (hétfőtől péntekig 9.00-15.00-ig). Josef Kling EXACT Personal UG 83224.Grassau (német munkaközvetítő cég Bajorországban) Cégjegyzék száma: HRB 25122 Traunstein (közvetítési vagy egyéb díj nincs) www.nemetmunka.hu


Feladva: 2018-07-07 15:52:06    

Címkék, kulcsszavak: NÉMET MUNKAFelszolgálókonyhai kisegítőpáros állásnémet munkanémet munkahely

Automatizált vevőszerző rendszer bármilyen online üzlethez. Ismerd meg,hogyan teheted egyszerűbbé és sikeressé az online üzleted egy automata vevőszerző rendszerrel. A rendszer tovább ajánlásával pénzt is kereshetsz. Fizetés hetente dollárban. Kattints az alábbi linkre, s kérd a videó összefoglalót https://tin yurl.hu/q8A1/
A hirdetés részletei >>


Feladva: 2018-07-06 19:04:25    

Címkék, kulcsszavak: automatavevőszerzőrendszer

Automatizált vevőszerző rendszer bármilyen online üzlethez. Ismerd meg,hogyan teheted egyszerűbbé és sikeressé az online üzleted egy automata vevőszerző rendszerrel. A rendszer tovább ajánlásával pénzt is kereshetsz. Fizetés hetente dollárban. Kattints az alábbi linkre, s kérd a videó összefoglalót https://tin yurl.hu/q8A1/
A hirdetés részletei >>


Feladva: 2018-07-06 18:27:14    

Címkék, kulcsszavak: automatizáltvevőszerzőrendszer

Belvárosi vegyes fűtésű (gáz és cserépkályha), zárt udvari I. emeleti, 75 nm-es, 2 szobás, felújított lakás kiadó.
A hirdetés részletei >>


Feladva: 2018-07-06 17:54:38    

Belvárosi vegyes fűtésű (gáz és cserépkályha), zárt udvari I. emeleti, 75 nm-es, 2 szobás, felújított lakás kiadó.
A hirdetés részletei >>


Feladva: 2018-07-06 17:53:30    

Belvárosi vegyes fűtésű (gázkonvektor és cserépkályha), zárt udvari I. emeleti, 75 nm-es, 2 szobás, felújított lakás eladó.
A hirdetés részletei >>


Feladva: 2018-07-06 17:50:24    

Régi,lekopott, vagy vizköves fürdőkádját újrazománcozzuk a helyszinen. Garanciával Szinesre is! Bontás nélkül Tel: 294-60-57. 0620-33-12-456.
A hirdetés részletei >>


Feladva: 2018-07-06 12:10:34    

Régi,lekopott, vagy vizköves fürdőkádját újrazománcozzuk a helyszinen. Garanciával Szinesre is! Bontás nélkül Tel: 294-60-57. 0620-33-12-456.
A hirdetés részletei >>


Feladva: 2018-07-06 12:05:48    

Címkék, kulcsszavak: Fürdökád javitás

Automatizált vevőszerző rendszer bármilyen online üzlethez. Ismerd meg,hogyan teheted egyszerűbbé és sikeressé az online üzleted egy automata vevőszerző rendszerrel. A rendszer tovább ajánlásával pénzt is kereshetsz. Fizetés hetente dollárban. Kattints az alábbi linkre, s kérd a videó összefoglalót https://tinyurl.hu/q8A1/
A hirdetés részletei >>


Feladva: 2018-07-05 23:49:27    

Címkék, kulcsszavak: automata vevőszerző rendszer

DIÁK ALBÉRLET! Apartman kiadó 2 szobás 2-4 főig! w.szegedimaganszallas.hu T: 30/218-9565
A hirdetés részletei >>


Feladva: 2018-07-05 19:35:14    

Így lehet pénzed ingyen regisztrációból! XRP0 Vajon tudod, hogy mi ez? Lehet, hogyha nem vagy tájékozott a coinok világában, akkor a következő pár mondatból semmit sem fogsz (még) érteni. Ha ez így van, akkor kattints. Csináld meg az ingyenes regisztrációt! Ebből semmilyen károd nem fog származni, ellenben biztos meg fogsz lepődni. Szóval a lényeg: 2019. január 1-én fogják bevezetni a Cryptopia nevű cointőzsdére XRP0 kódnéven a Ripple-Zero vagy inkább ZeroXRipple nevű coint, ... további részletek >>

0,03 dolláros, tehát 3 centes áron! Jelenleg már látható ez a coin, pontosabban a coin tokenje az Etherscan oldalon. Ott, ahol az új ICO-kat, tokeneket nyilvánosságra szokták hozni. Persze előre nem lehet tudni, hogy január 1. után, és később mekkora lesz az új coin árfolyama, jelenleg 3 centtel számolva (ez már folyamatosan változik) a 25.000 ajándék-coinod 750 dollárt fog érni. De nem kell elfeledni, hogy ingyen jutottál hozzá! Csak annyit kell tenned, hogy megcsinálod az ingyen regisztrációt! A regisztrációhoz kattints IDE https://xrpzero.com/signup/7DT6ZLKCEW Ha tovább akarod bővíteni a conjaid számát, akkor ajánld másoknak is. Minden egyes új regisztrálód után 10.000 darabot kapsz a coinból. Figyelem: egy gépről (hálózati végpont) csak egy regisztráció történhet, mert a rendszer nem enged többet. Szerintem ez kihagyhatatlan. Mit veszíthet az ember? Botos Lajos Infó: lajos.botos50@gmail.com


Feladva: 2018-07-05 12:02:37    

Mindig is kerestem az olyan lehetőségeket, amivel olyan bevételt tudok generálni magamnak, ami folyamatos, bevételt termel. Keress pénzt napenergiával úgy, hogy nem kell napelemeket üzembe helyezned és karbantartanod. 25 évre szóló szerződéssel, a megvásárolt (Wattok után) teljesítményre, jövedelmet biztosít euroban!
A hirdetés részletei >>


Feladva: 2018-07-05 11:36:33    

Címkék, kulcsszavak: onlinemunkaeurosnapenergia

Mindig is kerestem az olyan lehetőségeket, amivel olyan bevételt tudok generálni magamnak, ami folyamatos, bevételt termel. Keress pénzt napenergiával úgy, hogy nem kell napelemeket üzembe helyezned és karbantartanod. 25 évre szóló szerződéssel, a megvásárolt (Wattok után) teljesítményre, jövedelmet biztosít euroban!
A hirdetés részletei >>


Feladva: 2018-07-05 11:36:28    

Címkék, kulcsszavak: onlinemunkaeurosnapenergia

20 db formatervezett, füles, címeres borosüveg eladók 1 literesek!
A hirdetés részletei >>


Feladva: 2018-07-05 08:13:31    

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-05 07:53:11    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-05 07:52:49    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-05 07:52:28    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-05 07:32:01    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-05 07:31:41    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

TV szervizünk vállalja CRT televíziók, PLAZMA TV, és LCD TV javítását. Villámcsapás miatt meghibásodott készüléket is javítunk, illetve szakvéleményt készítünk, kárrendezés céljából a biztosító felé. Kiszállás a következő kerületekben: Budapest, VIII. IX. X. XVII. XVIII. XIX. XX. XXI. XXIII. kerületeiben. Kispest , Kőbánya , Erzsébet , Csepel , Soroksár , Pestimre , Pestszentlőrinc. Pest megyében: Vecsés, Gyál.
A hirdetés részletei >>


Feladva: 2018-07-05 07:31:16    

Címkék, kulcsszavak: tv javításlcd javítástv szervízlcd szervíz

Dalmáciában, Zadartól 23 km-re délre, 4 km-re Biográd előtt helyezkedik el TURANJ.(Budapesttől 633 km) Ideális helyen, a tengerparton végigfutó Adriai Főút mellett fekszik, gyorsan elérhetők a turisztikai helyek, Zadar, Nin, Biográd, Krka, Sibenik, Split. Sok hajós program indul a Kornáti szigetekhez és a szemközti szigetekhez is. A kiépített tengerparton egymást váltják, a kávézok, konobák, boltok, árusok. A parti sétányon egészen Biográd központjáig be lehet sétálni. Turanj központjában, új ... további részletek >>

építésű úszómedencés ZARA kempingben klímás, wifis, tv-s mobilházak kiadók. Magyar személyzet, programok. Tel: 0631 7898920 (WhatsApp, Viber) virservistravel.hr@gmail.com http://horvatorszag-turanj.hu/ https://www.facebook.com/virservicetravel/ http://horvatorszag-turanj.hu/mobilhome.pdf


Feladva: 2018-07-05 06:52:25    

Címkék, kulcsszavak: HorvátországDalmáciaBiograd-Turanj. Klímás wifistv-s mobilházak kiadók

Vállalom régi és új tetők mindenre kiterjedő felújítását, javítását! Pala-cseréptetők mosása, festése, javítása! Tetőbeázások megszüntetése! Garanciával! www.palatetotisztitas.hu
A hirdetés részletei >>


Feladva: 2018-07-04 11:39:15    

Címkék, kulcsszavak: tetőpalacserépmosásjavítás

Fincsi masszázs! Masszázs akár AZONNAL! Hétvégén is. Ha szereted a finom érintést, ha fáj a hátad, lábad, vállad ... Vagy csak lazulnál egyet ... Fizethetsz utalvánnyal is. (Erzsébet, Sodexo, Edenred) Hívj! Vagy mentsd el a számomat! 06 30 7226413 10 vendégből 9 visszajön :) Ha kipróbálnád Te is, szeretettel várlak Kecskeméten a Széchenyivárosban csendes környezetben.
A hirdetés részletei >>


Feladva: 2018-07-04 11:38:49    

Fincsi masszázs! Masszázs akár AZONNAL! Hétvégén is. Ha szereted a finom érintést, ha fáj a hátad, lábad, vállad ... Vagy csak lazulnál egyet ... Fizethetsz utalvánnyal is. (Erzsébet, Sodexo, Edenred) Hívj! Vagy mentsd el a számomat! 06 30 7226314 10 vendégből 9 visszajön :) Ha kipróbálnád Te is, szeretettel várlak Kecskeméten a Széchenyivárosban csendes környezetben.
A hirdetés részletei >>


Feladva: 2018-07-04 11:28:18    

Címkék, kulcsszavak: Masszázs kecskemét

Szüksége van egy hitelre a számlák megfizetésére vagy egy új vállalkozás megkezdésére? további információért forduljon hozzám. harrybale699@gmail.com
A hirdetés részletei >>


Feladva: 2018-07-04 11:09:07    

Vagyonőröket keresünk Győrbe, üzlettér őrzésére. Bejelentett, főállású munka, nincs alvállalkozó! Kezdő bérezés nettó 700 Ft/óra. Hétköznap és hétvégén is szabadnapokkal, csak nappali időszakra. Jelentkezni lehet szakmai, fényképes önéletrajzzal az allaspalyazat@yandex.com címre. Folyamatosan várjuk a jelentkezőket!
A hirdetés részletei >>


Feladva: 2018-07-04 10:21:31    

A ZOÉ Security Kft elsősorban Veszprém megyében, de az ország egész területén is vállal vagyonvédelmi megbízatást. Rugalmas alkalmazkodás az adott feladathoz, kedvező vállalási ár!
A hirdetés részletei >>


Feladva: 2018-07-04 08:32:24    

Teljeskőrű fémfelújitás:festés,csiszolás,polír ozás,hegesztés.....
A hirdetés részletei >>


Feladva: 2018-07-03 21:42:46    

Van-e olyan hiteled, amit a végrehajtó fenyeget? Magadon kívül hány főről kell gondoskodnod havonta? Mi lenne az az összeg, ami havi szinten megoldaná a legsürgetőbb gondokat? Gondolsz-e arra, hogy egy nagyobb váratlan kiadást miből fogsz fedezni? Itt a megoldás: https://senoffers.com/go/32
A hirdetés részletei >>


Feladva: 2018-07-03 20:40:22    

A SunMoney Globális közösségi naperőmű programban bárki vehet akár 2 euróért napelemcsomagot, 30 euróért közösségi csomagot. A naperőműveink által megtermelt villamos-áram értékesítéséből származó bevételt minden hónapban arányosan elosztja a közösségen belül. A futamidő 25 évre szól! Akarsz-e részese lenni?
A hirdetés részletei >>


Feladva: 2018-07-03 16:45:19    

Címkék, kulcsszavak: anyagibiztonságmunkaonline

Ingatlanüzemeltető cég munkatársakat keres ingatlanok zöldterületeinek ápolására (fűnyírás, fák-bokrok metszése), épületek kisebb karbantartási - javítási munkáinak elvégzésére. Mezőgazdasági /kertészeti és / vagy műszaki és /vagy építőipari ismeretekkel - gyakorlattal rendelkező munkatársakat keresünk, Szolnokra. A munkakör nincs végzettséghez kötve, csak becsületes, lelkiismeretes, dolgozni akaró munkatársakat keresünk. A jelentkező lehet pályakezdő, de nyugdíjas is. Napi 8 órás munkarend, ... további részletek >>

bejelentett főállású munka, korrekt munkavégzési feltételek, vidékieknek utazási költségtérítés. Kezdő bérezés minimálbér (br.138.000). Jelentkezni fényképes szakmai önéletrajzzal a bi.technika@gmail.com címen lehetséges. Folyamatosan várjuk a jelentkezőket!


Feladva: 2018-07-03 14:36:39    

NÉMET MUNKA –folyamatosan 45-60 db állásunk van. A bért mindig kiírjuk. Szállás mindig van. Részletek a következő linkekre kattintva olvashatóak: http://www.nemetmunka.hu/allasaink.html és http://www.nemetmunka.hu/vendeglatos-munka.html MAI állásajánlatunk: Nr. 185 Kamionos állás CE+95 , Saarbrücken közelében Azonnali belépéssel keresünk gépkocsivezetőt CE+95 jogosítvánnyal és kamionos német, francia vagy angol nyelvtudás valamelyikével. A fizetés 2400€ bruttó + 400-600€ ... további részletek >>

nettó napidíj. (A fuvaroktól függ, hogy mennyi a napidíj.) A gépkocsipark sokrétű, mert a nyergesvontatótól a hűtőkamionig sok féle autótípussal rendelkeznek. A német speditőr cég fuvarozási területe Franciaország ( Párizs és környéke ) és Németország Köln magasságáig, és Baden Würtenberg, de más területek is, a megrendelésektől függően.( Következő relációk: 02, 60, 27, 28, 89, 76 és 45.) A cég 45 éves, családi vállalkozás Minden állásunk betöltésével német nyelvű munkaszerződést kap a dolgozó, amely megértésében, átbeszélésében igény szerint szívesen segítünk. Hosszútávú munkát keresőkre számítunk. A munkaközvetítésért vagy egyéb másért fizetni, ill. bármit aláírni nem kell! Jelentkezni lehet (e-mailben, regisztrálással vagy telefonon): 1.) E-mailben: info@nemetmunka.hu (telefonszám megadásával) 2.) Ingyenes regisztrációval a következő linkre kattintva: http://www.nemetmunka.hu/regisztracio-nemetorszagi-munkavegzesre.html 3.) Telefonon hétfőtől-péntekig a magyar 06 1 920 3433, ill. a német 0049 8641 6949 000 vezetékes számokon (hétfőtől péntekig 9.00-15.00-ig). Josef Kling EXACT Personal UG 83224.Grassau (német munkaközvetítő cég Bajorországban) Cégjegyzék száma: HRB 25122 Traunstein (közvetítési vagy egyéb díj nincs) www.nemetmunka.hu


Feladva: 2018-07-03 13:45:33    

Címkék, kulcsszavak: NÉMET MUNKAkamionossofőr

Azonnali kezdéssel villanyszerelőket keresünk németországi (München) gyengeáramos villanyszerelési munkákra. Német nyelvtudás és saját autó előny.
A hirdetés részletei >>


Feladva: 2018-07-03 11:43:33    

Egyszerű és ingyenes hirdetési lehetőséggel várunk mindenkit az oldalunkon. Meghirdetheti nálunk szolgáltatásait, kínálatát és minden mást. Az oldalunkon adott minden ahhoz, hogy Önnek tetsző hosszúságú és feladási időtartalmú hirdetést adjon föl. Az oldalunk igényes abban a tekintetben, hogy ugyanaz a hirdetés csak egyszer jelenik meg a lejártáig. Ez elősegíti, hogy a böngészők könnyen áttekintsék az oldalt és az őket érdeklő hirdetéseket. Az Ön hirdetését is szívesen látjuk az oldalunkon!
A hirdetés részletei >>


Feladva: 2018-07-03 11:00:17    

Címkék, kulcsszavak: apróhirdetésingyenes hirdetés

Dinamikusan növekvő kis vállalkozás keres CNC maróst Elvárások: - CNC Marógépen önálló munkavégzés, 3D modellek alapján - Minimum 3-5 év hasonló munkakörben szerzett tapasztalat - Dinamikus csapatmunkában való részvétel - EdgeCam és Hurco Ultimax4 ismeret előny Amit kínálunk: - Versenyképes, biztos jövedelem és juttatási csomag - Egyedi gyártás, többségében alumínium munkák - Egy műszakos munkarend 8 órától 16 óráig. - A gép kezeléséhez betanítási időre van lehetőség - Gazdagon ... további részletek >>

felszerelt műhely - Kommunikatív, segítőkész vezetőség - Családbarát környezet - Hosszú távú biztos munkahely Munkavégzés helye: - Balatonalmádi Jelentkezés módja: - Telefonon: 06305638424 - E-mailben: smgt.info@gmail.hu


Feladva: 2018-07-02 21:20:56    

Címkék, kulcsszavak: cncmarósbalatonállás; egyműszakos

Sárszentmihály központjában, csendes környéken közművesített építési telek eladó!
A hirdetés részletei >>


Feladva: 2018-07-02 18:08:52    

Sárszentmihály központjában, csendes környéken közművesített építési telek eladó!
A hirdetés részletei >>


Feladva: 2018-07-02 18:04:42    

Kiválóan működő sugárfúrógép profilváltás miatt eladó.
A hirdetés részletei >>


Feladva: 2018-07-02 17:39:05    

Kiválóan működő sugárfúrógép profilváltás miatt eladó.
A hirdetés részletei >>


Feladva: 2018-07-02 17:15:50    

Feladatok:  Költségvetés-árajánlat készítése  Pályázati anyagok és elnyert munkák műszaki előkészítése  Bekerülési költség meghatározása  Mennyiségi számítások  Műszaki tartalom meghatározása  Műszaki alternatívák és észrevételek kidolgozása  Kapcsolattartás alvállalkozókkal, beszállítókkal  Tervek, költségvetések, műszaki paraméterek alapján alvállalkozói és beszállítói ajánlatok bekérése, alvállalkozók felkutatása ... további részletek >>

 Generálkivitelezői, alvállalkozói szerződések előkészítése Elvárások:  Szakirányú – minimum - középfokú végzettség  MS Office programok kiváló ismerete – Excel kiemelten  Önálló és csapatmunka végzésre alkalmas, motivált személyiség  Terhelhetőség, rugalmasság, precizitás  Tervező programok felhasználó szintű ismerete Előnyt jelent:  Költségvetés-készítő programok ismerete  Szakmai tapasztalat  Felsőfokú szakmai végzettség (építész- vagy építőmérnök) Munkavégzés helye: Pécs Jelentkezés módja: fényképes önéletrajzzal az info@vivapalazzo.hu e-mail címen.


Feladva: 2018-07-02 15:11:18    

Feladatok:  Költségvetés-árajánlat készítése  Pályázati anyagok és elnyert munkák műszaki előkészítése  Bekerülési költség meghatározása  Mennyiségi számítások  Műszaki tartalom meghatározása  Műszaki alternatívák és észrevételek kidolgozása  Kapcsolattartás alvállalkozókkal, beszállítókkal  Tervek, költségvetések, műszaki paraméterek alapján alvállalkozói és beszállítói ajánlatok bekérése, alvállalkozók felkutatása ... további részletek >>

 Generálkivitelezői, alvállalkozói szerződések előkészítése Elvárások:  Szakirányú – minimum - középfokú végzettség  MS Office programok kiváló ismerete – Excel kiemelten  Önálló és csapatmunka végzésre alkalmas, motivált személyiség  Terhelhetőség, rugalmasság, precizitás  Tervező programok felhasználó szintű ismerete Előnyt jelent:  Költségvetés-készítő programok ismerete  Szakmai tapasztalat  Felsőfokú szakmai végzettség (építész- vagy építőmérnök) Munkavégzés helye: Pécs Jelentkezés módja: fényképes önéletrajzzal az info@vivapalazzo.hu e-mail címen.


Feladva: 2018-07-02 14:47:56    

P-tech vadháló, félkemény huzalból, oszlop távolság elég a 4-5 méter , csúszás mentes kötés, garancia a minőségre! ! Bizonytalan és hamis világunkban olyat kínálunk , ami tényleg abból van , aminek mondjuk, ott készül , ahol mondjuk, célnak megfelelő vadhálót kínálunk és tovább él , mint gondolnák! Válaszon minket , mert lehet, hogy az ” olcsó kerítés, vadháló” lesz a legdrágább , amikor 1-2 éven belül újra kell építeni az egészet! Weboldalunkon megtekinthető a Videó a P-tech ... további részletek >>

vadhálóról! Kérjen ajánlatot! Szállítás az ország egész területére! Tel. 0670/770-3460 www. vadhalo. eu


Feladva: 2018-07-02 11:10:30    

Címkék, kulcsszavak: vadhálódrótfonatkerítésdrótoszlop

A Fogszabályozás alapismeretek, amiket ismerni kell fogszabályozás előtt. Megtudhatja, hogy Önnek valóban fogszabályozóra van-e szüksége, legyen szó gyermekkori fogszabályozásról vagy felnőttkori fogszabályozásról. Lágy erőkkel, állkapocs izületi terápiával, láthatatlan fogszabályozó készülékkel, Budapesten. https://fogszabalyozascentrum.hu/
A hirdetés részletei >>


Feladva: 2018-07-02 10:49:54    

Címkék, kulcsszavak: fogszabályozásfogszabályozás Budapestfogszabályozás CentrumMODERN FOGSZABÁLYOZÓ KÉSZÜLÉKEKLágy erővel működő fogszabályzóEsztétikus fogszabályozásfájdalommentes fogsza

Siófok Kiliti városrészén, a Ságvári u.10.sz alatti 145 m2-es, kétszintes, részben felújított, családi ház 1100 m2-es telekkel, eladó! A házat barátságos, meleg színek, nagy terek jellemzik. A földszint lényegében egy légterű, itt kapott helyet a konyha, étkező, kádas fürdőszoba és egy 44 m2-es tágas nappali, a tetőtérben 2 egész és 1 fél szoba, társalgó, zuhanyzós fürdőszoba és egy 12 m2-es fedett terasz található. A teraszról a ságvári dombság panorámájában gyönyörködhetünk, míg a hálószobák ... további részletek >>

ablakaiból a Balatoni hegyekig lehet ellátni. Az épület 2011-2012-ben nagy felújításon esett át, ekkor külső szigetelést kapott, teljes víz és villanyvezeték csere történt, a 2 fürdőszoba teljes felújítására és átalakítására, valamint hőszigetelt nyílászárók beépítésére került sor, így az igazán rombolással járó munkálatok már elkészültek. Jelenleg, takarékos megoldásként egy cserépkályha biztosítja a barátságos meleget, de gázkonvektorok és villanyfűtés is rendelkezésre áll. Bevásárlóközpont 1 km, orvos, gyógyszertár, hentes, iskola, óvodák pár perc sétára találhatók. Tömegközlekedés kb:100m. 2 generáció együtt, mégis külön lakhatására is alkalmas, könnyen szétválasztható. Irány ára:23.9 MFt. Tel:70/336-1995,30/5090-395 email: viraghalmi.tamas@gmail.com


Feladva: 2018-07-01 14:36:06    

NÉMET MUNKA - felszolgáló nő, pultos, Rasthof kiszolgáló Nr. 119 Fiatal felszolgáló női német állás az Allgäu-ban a Neuschwanstein -i kastély közelében Német felszolgálói állás fiatal lány részére A2 némettel, aki picit tud angolul is. A fizetés 1840-2200€ bruttó, (ez kb. 1300€-1500€ nettó) A munkahét 6 napos 9,00-17,00 óráig tartó munkaidővel. A szállás és a munkaidő alatti étkezés ingyenes. A feladat a vendégek gyors kiszolgálása. Felszolgálói végzettség nem feltétlenül ... további részletek >>

kell, de 4 tányár ki kell tudni vinni egyszerre. Az Allgäu Németország egyik legszebb része hegyekkel körülvéve, amely élményt még megnöveli a Füssen-i Neuschanstein-i kastély látképe, amelynek sok-sok tornyocskáját a Disney rajzfilmekből szinte mindenki ismeri. Nr.147 Pultos / Thekenkraft német állás Freiburg nál Azonnali belépéssel pultos /Thekenkraft német munkahely A2 némettudással 1521€ bruttó fizetésért 169 óra munkaidővel. Az étkezés ingyenes, a szállás rezsivel és WIFI-vel 180€ / hónap. A szállás a munkahelytől 200 méterre van egy 3 szintes szolgálati lakásban ahol összesen 6 külön szoba van, 2 szobánként van közös WC és fürdőszoba. Az alsó szinten van a közös konyha és étkező. A középső szinten van egy nagy fürdőszoba mosógéppel és szárító géppel. Ez egy szezonos állás, ami 2019 január 10-ig tart. Nr.177 Rasthof kiszolgáló német állás 20 helyen Németországban A német autópályákon, 20 helyen lévő autópálya pihenőkbe, Rasthaus-ba keresünk szimpatikus női és férfi kiszolgáló személyzetet. Felszolgálói végzettség nem kell, de a jó némettudás (B1-től) szükséges. A német munkahely dolgozóinak a feladata az önkiszolgáló étteremben, kávézóban és a pultnál történő kiszolgálás és a kasszánál történő munkavégzés. Változó munkarend van. A munkahét 5 napos, 173 óra / hónap. A fizetés 1.557€ bruttó plusz a pótlékok. (délutáni, éjszakai, stb) Az estleges túlórákat szabadidőben kiadják előzetes egyeztetés alapján. Étkezés személyzeti áron, (50% kedvezmény) Szállás 150€/hónap vagy egyéni megegyezés szerint. Minden állásunk betöltésével német nyelvű munkaszerződést kap a dolgozó, amely megértésében, átbeszélésében igény szerint szívesen segítünk. Hosszútávú munkát keresőkre számítunk. A munkaközvetítésért vagy egyéb másért fizetni, ill. bármit aláírni nem kell! Jelentkezni lehet (e-mailben, regisztrálással vagy telefonon): 1.) E-mailben: info@nemetmunka.hu (telefonszám megadásával) 2.) Ingyenes regisztrációval a következő linkre kattintva: http://www.nemetmunka.hu/regisztracio-nemetorszagi-munkaveg zesre.html 3.) Telefonon hétfőtől-péntekig a magyar 06 1 920 3433, ill. a német 0049 8641 6949 000 vezetékes számokon (hétfőtől péntekig 9.00-15.00-ig). Josef Kling-EXACT Personal UG (német munkaközvetítő cég Bajorországban) Cégjegyzék száma: HRB 25122 Traunstein (közvetítési vagy egyéb díj nincs) www.nemetmunka.hu


Feladva: 2018-07-01 11:16:32    

Címkék, kulcsszavak: NÉMET MUNKAfelszolgáló nőpultosRasthof kiszolgáló

Gyógypedikűr+gél lakk Akció! www.ujpestifodraszat.gportal.hu
A hirdetés részletei >>


Feladva: 2018-07-01 08:37:47    

Idősgondozót keresek Édesanyám mellé /85 éves/ kedves, barátságos 60év feletti gondozónőt keresek egész napra ott lakással. Nem ágyhoz kötött, de nem szeret egyedül lenni. Inkább felügyelni kellene rá. Lehet szakképzetlen, nyugdíjas is Bér megegyezés szerint.
A hirdetés részletei >>


Feladva: 2018-07-01 07:59:52    

Idősgondozót keresek Édesanyám mellé /85 éves/ kedves, barátságos 60év feletti gondozónőt keresek egész napra ott lakással. Nem ágyhoz kötött, de nem szeret egyedül lenni. Inkább felügyelni kellene rá. Lehet szakképzetlen, nyugdíjas is Bér megegyezés szerint.
A hirdetés részletei >>


Feladva: 2018-07-01 07:51:25    

Idősgondozót keresek Édesanyám mellé /85 éves/ kedves, barátságos 60év feletti gondozónőt keresek egész napra ott lakással. Nem ágyhoz kötött, de nem szeret egyedül lenni. Inkább felügyelni kellene rá. Lehet szakképzetlen, nyugdíjas is Bér megegyezés szerint.
A hirdetés részletei >>


Feladva: 2018-07-01 07:45:18    

Keres egy üzleti hitel? Személyi hitel, diákhitel, diákhitel, diákhitel, adósság konszolidációs hitelt, fedezetlen hitel, kockázati tőke, stb ha igen írj nekünk ma: (dakany.endre@gmail.com) és kap a hitel Ma. Sürgős kölcsön ajánlat.
A hirdetés részletei >>


Feladva: 2018-07-01 01:44:27    

Címkék, kulcsszavak: Hitel ajánlat.

Beruházásod biztosítja a termelés utáni havi jutalékodat, nincs kockázat, mert a nap süt, a termelő eszközök pedig energiát – pénzt termelnek. Nem kötelező semmi, eladható, elajándékozható és örökölhető! Ha felkeltettem az érdeklődésedet, keress meg, segítek elindulni és megtanítunk mindenre, hogy sikeres legyél ebben az üzletben! Érdekel?? ITT elérhetsz E-mail: pir osed@gmail.com
A hirdetés részletei >>


Feladva: 2018-06-30 23:30:47    

A szépség és a fiatalság nem elérhetetlen. Nézzen fel honlapomra! Dr. Rusz Zoltán, plasztikai sebész vagyok. Weboldalamon megtalálja a referenciamunkáimról készült fotókat, és szakmai önéletrajzomat is elolvashatja
A hirdetés részletei >>


Feladva: 2018-06-30 22:30:04    

Ékszerek , pénztárcák és órák hatalmas árkedvezménnyel a Lili Bizsu webáruházban akár 60-80 %-os kedvezménnyel a készlet erejéig
A hirdetés részletei >>


Feladva: 2018-06-30 20:41:43    

Címkék, kulcsszavak: bizsu webáruházékszer webshopakciós karperecezüst színű ékszerkarkötőkarperecbizsuékszeraranystrasszstrasszkövesstrassz ékszer

Ékszerek , pénztárcák és órák hatalmas árkedvezménnyel a Lili Bizsu webáruházban akár 60-80 %-os kedvezménnyel a készlet erejéig
A hirdetés részletei >>


Feladva: 2018-06-30 20:40:33    

Címkék, kulcsszavak: bizsu webáruházékszer webshopakciós karperecezüst színű ékszerkarkötőkarperecbizsuékszeraranystrasszstrasszkövesstrassz ékszer

Ékszerek , pénztárcák és órák hatalmas árkedvezménnyel a Lili Bizsu webáruházban akár 60-80 %-os kedvezménnyel a készlet erejéig
A hirdetés részletei >>


Feladva: 2018-06-30 20:39:39    

Címkék, kulcsszavak: bizsu webáruházékszer webshopakciós karperecezüst színű ékszerkarkötőkarperecbizsuékszeraranystrasszstrasszkövesstrassz ékszer

Ékszerek , pénztárcák és órák hatalmas árkedvezménnyel a Lili Bizsu webáruházban akár 60-80 %-os kedvezménnyel a készlet erejéig
A hirdetés részletei >>


Feladva: 2018-06-30 20:38:47    

Címkék, kulcsszavak: bizsu webáruházékszer webshopakciós karperecezüst színű ékszerkarkötőkarperecbizsuékszeraranystrasszstrasszkövesstrassz ékszer

Ékszerek , pénztárcák és órák hatalmas árkedvezménnyel a Lili Bizsu webáruházban akár 60-80 %-os kedvezménnyel a készlet erejéig
A hirdetés részletei >>


Feladva: 2018-06-30 20:37:50    

Címkék, kulcsszavak: bizsu webáruházékszer webshopakciós karperecezüst színű ékszerkarkötőkarperecbizsuékszeraranystrasszstrasszkövesstrassz ékszer



Kategóriák:


tegnap, 2 napja, 3 napja, 4 napja, 5 napja, 6 napja



Legkeresettebbek

•   XBOX 360   •   pc bolt   •   fém   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360   •   hűtő   •   olcsó garancia   •   kiállitás   •   eps   •   vas eladó   •   Bál   •   eladó ház   •   kerék   •   UE 28   •   vasarlas   •   tart 1   •   füvesítés   •   ecomaxpoweredbyaltoc ms   •   1000poweredbyaltocms boldog   •   CAT   •   Bál1111111111111"   •   tart 11111111111111"   •   tart 11111111111111   •   költöztetés   •   about:blank   •   toll összeszerelés   •   német   •   Bál1111111111111   •   hitel   •   masszazs   •   tv   •   lcd   •   apolo   •   nyíregyháza   •   1.5   •   magánhitel   •   nyelv   •   Eladó   •   paypal   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3)))   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3))   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3)   •   xbox 360 && SLEEP(3) oRDeR BY 638 #   •   si cu   •   olcsó családi ház   •   szabads   •   kisebb   •   dealkodex   •   traktor xmlrpc php   •   bďż˝dogos esztergom   •   freedom  

TOP keresések

•   állás munka   •   ingatlan   •   honlap készítés   •   ingyen zene   •   ingyen játékok   •   olcsó weboldal   •   apróhirdetés   •   weboldal készítés   •   facebook   •   ingyen hirdetés   •   ingyen apróhirdetés   •   vacsoracsata   •   térkép   •   youtube   •   iwiw   •   magyarország   •   mobilbarát honlap   •   honlap olcsón   •   budapest   •   ingyen   •   szótár  

Most keresik

•   struktúráját   •   sebek ke   •   Sebestyén   •   Snapdragon   •   bármikorra   •   kútfúrás hajdú bihar   •   ój   •   Ä?Â?TI   •   Hummelg   •   anionindexphpadminis tratorcomponentscust omeraccountvirtueopt ioncomjanews   •   lakatos Ferihegy   •   Plc   •   sz l stelep   •   Könyvelői szolgáltatás   •   Napelemes tanfolyam infrafűtés   •   pihenő idő   •   vin   •   aaaaaaaaacgaaaaaaaaa cs   •   könyv eladás vásárlás   •   nulla   •   Mogul   •   haszongďĹźË p   •   kďż˝pesek   •   börtönr l   •   7 le kistraktor   •   hďż˝nap   •   bejelentettmunkanyir   •   biztosítókra   •   alagutakban   •   dió2121121121212.1   •   palackozó   •   beton keverés   •   frissc4202020c42020c   •   Mostüzlet2010januárj   •   63740ll63740stkn6374 0 l   •   de befektetésreisalkalm as   •   LAPOSTETŐ SZIGETELŐ   •   balk   •   szoftverfejesztďż˝s   •   biztonságiajtózárcse   •   bi flux   •   részvét   •   aut 20busz   •   h szig   •   IFA   •   utas szálítás   •   elmetszett   •   faragott falióra   •   kaphatja   •   8900