
epoxi asztalok és felületek gyártása.
A hirdetés részletei >>

Feladva: 2018-07-09 11:20:37    

Címkék, kulcsszavak: epoxy tbleepoxi asztal

Németországi tartós munkavégzésre keresünk szakembereket. Elektroműszerészt, mechanikai műszerészt, géplakatost, villanyszerelőt, hegesztőt, asztalost, porfestőt, logisztikust. Nincs semmilyen előzetes költség,közvetítői díj. Szerződés a német céggel,bejelentéssel, biztosítással, adószámmal. Berendezett lakás biztosított ingyen, igény esetén akár családdal is, minimális költséghozzájárulás ellenében. Versenyképes fizetés, túlórapótlék,munkába járási hozzájárulás, teljes ügyintézés. ... további részletek >>

Jelentkezni lehet e-mailban, német nyelven. ( Önéletrajz,bemutatkozó levél,bizonyítványok, telefonos elérhetőség szükséges. Kiutazás megegyezés szerint, akár napokon belül.

Feladva: 2018-06-06 20:07:14    

akril asztalok és burkolatok készítése.Természetes anyagok impregnálásával.Fa,kő,virág ,stb.
A hirdetés részletei >>

Feladva: 2018-05-30 13:12:43    

Címkék, kulcsszavak: akril asztalokakril burkolatok

keresünk dolgozni szerető asztalos,kőműves szakembert Váci munkahelyre.Fizetés megeggyezés szerint hetente.Jelentkezni lehet a 06/20 3372-871-es telefonszámon.
A hirdetés részletei >>

Feladva: 2018-05-28 17:05:30    

Neobarokk étkező bútor eladó. A bútor felújításra szorul. Öröklésből maradt a családra. Tartalma: 2 db szekrény, 1 ovális asztal székekkel.
A hirdetés részletei >>

Feladva: 2018-05-25 10:37:33    

Álláshirdetés alkalmankénti munkavégzésre Budapesti rendezvénytechnikai és kiállítás kivitelező cég keres rendezvények, díszletek, fesztiválok, kiállítások gyártásához, telepítéséhez, üzemeltetéséhez munkaerőt. Az alábbi szakmák képviselőinek jelentkezését várjuk: - asztalos, - lakatos, hegesztő, - villanyszerelő, - hang technikus (DMX vezérlésben is jártas), - fény technikus (DMX vezérlésben is jártas), - fényező, - vízvezeték szerelő, - dekoratőr - fizikai munkás (anyagmozgatás) ... további részletek >>

- Cnc operátor - Lézervágógép operátor - szőnyeges - Teherautó sofőr, anyagbeszerző (3,5t teherautó vezetésében rutinos kollégát keresünk). Pályakezdő fiatalok jelentkezését is várjuk. Elvárások: rugalmasság, precíz munkavégzés, alap munkavédelmi felszerelés megléte (munkavédelmi bakancs, sisak, kesztyű). Bemutatkozó levelét, önéletrajzát,esetleges referencia munkákat bérigény megjelölésével várjuk a e-mail címre.

Feladva: 2018-05-14 11:14:44    

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-25 22:57:10    

Címkék, kulcsszavak: ingatlaneladótengerparthorvátkiadónyaralászadarvakációolcsójetskyapartmanhomokosstrandbeachszállásbérelhetővehető

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-25 20:03:07    

Címkék, kulcsszavak: ingatlaneladótengerparthorvátkiadónyaralászadarvakációolcsójetskyapartmanhomokosstrandbeachszállásbérelhetővehető

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-18 17:52:38    

Címkék, kulcsszavak: nyaralásnyaralókiadótengerparthorvátZadarhomokosolcsóakciószálláshotel

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-18 17:46:13    

Címkék, kulcsszavak: nyaralásnyaralókiadótengerparthorvátZadarhomokosolcsóakciószálláshotel

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-18 17:09:58    

Címkék, kulcsszavak: nyaralásnyaralókiadótengerparthorvátZadarhomokosolcsóakciószálláshotel

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-18 16:49:54    

Címkék, kulcsszavak: nyaralásnyaralókiadótengerparthorvátZadarhomokosolcsóakciószálláshotel

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-18 16:37:59    

Címkék, kulcsszavak: nyaralásnyaralókiadótengerparthorvátZadarhomokosolcsóakciószálláshotel

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-18 16:31:57    

Címkék, kulcsszavak: nyaralásnyaralókiadótengerparthorvátZadarhomokosolcsóakciószálláshotel

Ati-apartman Zadar ,Diklo elit strandnegyed, 400 méterre a strandtol. beosztás: Foldszint,Kettő hálóteres: 1szoba 2 db kettőszemélyes ággyal,lcd-tv,agynemű 6 főre,teljes felszereltség+Konyha 2személyes ággyal. +Fürdő/wc- +saját terasz berendezve,1db nyári szobával+2főre aggyal,+napernyő ebédlőasztallal,székekkel,+uszómedence napozóteraszokkal. Privat Parkoló. fekvése,elhelyezkedése : Zadar elit strandnegyedében Diklo-ban,sétaúton390 méterre a parttól,egy dombon,zöldövezetben,csendes helyen. ... további részletek >>

Úszómedencével,parkolóval,napozóteraszokkal. Beosztása: 1 szoba,2db kétszemélyes ággyal,2-4 fő+ konyha a lakásban 1db.2 személyes ággyal,1-2 fő+saját terasz Nyári szobával+2före ággyal,+napernyővel,asztallal,székekkel a teraszon,stb.wifi,tv,teljes felszereltség. saját parkoló,az apartman lakóterülete 38 nm,terasz 30nm. Kilátás,elhehyezkedése: A teraszokról Gyönyörû panorámával a tengerre, szigetekre, AZ Óvárosra. Diszkrét magányban, mégis Kozel mindenhez. A Tengerpart, strandok kb 400méterre a háztól húzódnak, 7 km hosszan, váltakozva aprókavicsos vagy Homokos, Lassan mélyülő. A közelben,Nin-Történelmi kisvásoska mellett húzódik a Horvát tengerpart legnagyobb homokos strandja,lassan mélyülő ,már májusban is meleg kristálytiszta vizével,és gyógyiszapos öbleivel. Bevásárlási lehetőség, étterem, kévézók, buszállomás, sportpályák legközelebb 600 m-re. A Diklo strandnegyedből Séta-es autóút vezet AZ Óvárosig, melyet pálmák, strandok, hotelek, éttermek kisérnek, Rengeteg szórakozási, sportolási lehetőséggel. Árak: Akció Ápr.+Május ,120-170 euró/hét/apartman.Továbbá JUn.eleje-vége : 180-300 euró/hét/apartman,és ez vonatkozik szept.-Októberre is. JUl.-Aug. : 65-69euró/nap-4-6 fő alkulehetőséggel. Közvetlen infórmációkérés : Facebook: Rácz Attila Zadar, Linkje: ,email:, telefon,viber: +36205805343, Forródrót: +385917314511 Honlapunk:

Feladva: 2018-04-18 16:14:38    

Címkék, kulcsszavak: nyaralásnyaralókiadótengerparthorvátZadarhomokosolcsóakciószálláshotel

A JANKÓ APARTMANHÁZ a zalakarosi fürdőtől 800 m-re működik egész évben.ABC 50 m.-re, cukrászda 150 m.-re, a legközelebbi étterem 200 m.-re van. Az apartmanokhoz egyéni konyha-fürdõ-Wc és erkély vagy terasz tartozik kertibútorokkal. Az udvarban ingyenes zárt parkoló van,a szállás egész területén és a szobákban ingyenes a Wi-fi, SZÉPKÁRTYÁT ELFOGADUNK ! Az udvarban fedett kertipavilon szolgálja vendégeink további kényelmét,asztalokkal,padokkal,székekkel és hintaággyal. Elérhetőség: ... további részletek >>

Jankó Tamásné,8749 Zalakaros,Hegyalja utca 14 Telefon: +36 93 340581; Mobil: +36 30 2173272 E-mail: Web: Az egyéni erkélyes,egylégterű 2 fős (ára 3750 Ft/fő/éj) és a kétszobás 3 fős apartmanok (ára 3700 Ft/fő/éj) a Jankó Apartmanház udvari főépületében találhatók.Minkét apartmantípus pótágyazható szobánként max.1 gyermek részére (ára:1500 Ft/fő/éj) 14 évig. A szobában kényelmes ágyak,prakrtikus bútorok,fotel,asztal, székek,külön olvasólámpák és falifogas van továbbá minden szobában külön TV van több mint 60 csatornával.Fürdő-Wc tartozik az apartmanhoz fürdőszobaszekrénnyel,mosdóval, zuhanyzóval, toalettpapírt,kézmosót,Wc fertőtlenítőt, ágyneműt és személyenként 2 db törölközőt adunk. A tetőtéri 1 fős (ára: 6900 Ft/fő/éj) vagy 2 fős (ára 3750 Ft/fő/éj) egyéni klímás apartmanok a Jankó Apartmanház utcai épületében találhatók és közös nagyméretű fedett terasz,valamint utcára néző erkély tartozik a 4 db apartmanhoz külön asztalokkal,székekkel. További felszereltségük ugyanaz mint a többi apartmané. Zalakarosról Zalakomár felé kiépített kerékpárúton érhető el a kápolnapusztai bivalyrezervátum (8 km),mely fontos szerepet játszik a faj fennmaradásában, génállományának megőrzésében.A Kis-Balaton déli partja mentén érjük el a Kányavári-Szigetet (12 km),melynek tanösvényén lehet bejárni és kilátójából megfigyelni a tájvédelmi körzet madárvilágát,egyéb természeti szépségeit. Zalakaros-Behiákpusztán (1 km) lehetőség van lovaglásra,kezdőknek futószáron,haladóknak lovardában és tereplovaglásra gyönyörű környezetben.Sétakocsikázás,hegyi pincés esték és évente díjugrató versenyek gazdagítják a programot.Tengerünk a Balatonˇ~25 km.-re Hévíz és a műemlékekben gazdag Keszthely ~30 km.-re,Nagykanizsa~18 km.-re, Szlovénia és a Horvát határátkelő ~50 km.-re,a megyeszékhely Zalaegerszeg 60 km.-re van tőlünk. Horgászatot kedvelőknek a galamboki horgásztó (2 km),a miháldi horgásztó (8 km),Kis-Balaton déli oldalán a Kányavári-Sziget,északi oldalán a zalavári út melletti rész (15 km) nyújt lehetőséget a kikapcsolódásra.Zalakaroson a helyi utazási irodákban országon belüli és a közeli országokba szervezett különféle 1 napos utazási programokra lehet befizetni. Zalakarosra könnyű eljutni az M7-es autópálya zalakomári lehajtóját elhagyva a 71-es uton Zalakomáron keresztül, vagy a 71-es úton továbbhaladva Galambokon keresztül. Vonattal érkező vendégeinknek célszerű Zalakomárban leszállni és menetrend szerint közl

Feladva: 2018-03-31 12:44:42    

Címkék, kulcsszavak: szállásgyógy és élményfürdőapartmanok

Eladó Zalakaroson egy jól működő,ismert apartmanház-panzió. A két épületből álló tehermentes családi ház 998 m2 telken,egy hr. számon épült és fizetővendéglátás-szállás céljára kialakítva működik. A ~540 m2 lakóterületen 20 ap.-szoba van,ebből 10 pótágyazható, 16 fürdő-wc,16 konyha van,a szállás egész területén kiépített a Wi-Fi. Az udvarban 40 m2-es fedett pavilon van és parkoló a gépkocsiknak. Az utcai épület pinceszintjén 35 m2-es szolgáltatóhelyiség van nagy ... további részletek >>

konyhával,mosdóval,wc-vel,továbbá egy 7 m2-es tároló gázkazánnal. A szakaszolható radiátoros fűtést és melegvizet gázkazán bíztosítja. Pinceszinten található egy különbejáratú 10 m2-es kamra mosdóval. Földszinten belső szobából nyíló,külső feljárós nagy utcai erkély van. Az épület földszintjén benyítva szépen berendezett fogadótér található tölgyfa ülőgarnitúrával,további asztalokkal,székekkel reggelíztetés céljára,ami egy étkezőasztalos nagy amerikai konyhában folytatódik. A fogadótérből előszobába jutva 4 db különbejáratú szoba és 2 db zuhanyzós fürdő-wc található,a nagyobbik fürdőszobában kád is van. Udvari lépcsőn az emeletre érve 29 m2-es fedett teraszt találunk,majd a folyosóról 4 db 2 fős tetőtéri apartman és 4.5 m2-es erkély nyílik. Az apartmanokban kábel Tv,klíma,fürdő-wc és konyha van hűtővel. Az udvari kétszintes új épületben szintenként 4 db 2 fős egyszobás és 1 db 4 fős,kétszobás apartman van,mindenhol egyéni erkéllyel.Minden apartmanban fürdő-wc,konyha van hűtővel, szobánként kábel Tv-vel. A szakaszolható radiátoros fűtést és melegvizet gázkazán bíztosítja. Földszinten kazánház,emeleten ágyneműtároló van,mérete 2.1-2.1 m2. Az épület padlástér járófelülete lefedett,hatalmas tárolóterületet ad. A városcentrum 500 m.-re van,az Európa hírű Gránit gyógy-termál és élményfürdő ~800 m.-re van,a sármelléki repülőtér~15 km.-re van,az M7-es autópálya lehajtó ~7 km.-re, a Balaton ~25 km.-re van tőlünk. Mi,a tulajdonos házaspár átadjuk vevőnek vendégkörünk és buszos partnereink listáját,az előfoglalásokat,több évtizedes tapasztalatunkat. A két ház teljes felszerelését,bútorzatát kínáljuk eladásra,a főszezon kezdetéig még nagyon kedvező áron,gyors beköltözéssel 99 mft.-ért. Többgenerációs család számára is bíztos megélhetés,jó befektetés. A nemzetközi és hazai foglalóoldalakon ismertségünk jól látható.; T: 003693340581; M: 0036302173272

Feladva: 2018-03-31 12:41:18    

Címkék, kulcsszavak: üdülőhelygyógy és élményfürdőjól működő befektetés

A JANKÓ APARTMANHÁZ a zalakarosi fürdőtől 800 m-re működik egész évben.ABC 350 m.-re, cukrászda 150 m.-re, a legközelebbi étterem 200 m.-re van. Az apartmanokhoz egyéni konyha-fürdõ-Wc és erkély vagy terasz tartozik kertibútorokkal. Az udvarban ingyenes zárt parkoló van,a szállás egész területén és a szobákban ingyenes a Wi-fi, SZÉPKÁRTYÁT ELFOGADUNK ! Az udvarban fedett kertipavilon szolgálja vendégeink további kényelmét,asztalokkal,padokkal,székekkel és hintaággyal. Elérhetőség: ... további részletek >>

Jankó Tamásné,8749 Zalakaros,Hegyalja utca 14 Telefon: +36 93 340581; Mobil: +36 30 2173272 E-mail: Web: Az egyéni erkélyes,egylégterű 2 fős (ára 3750 Ft/fő/éj) és a kétszobás 3 fős apartmanok (ára 3700 Ft/fő/éj) a Jankó Apartmanház udvari főépületében találhatók.Minkét apartmantípus pótágyazható szobánként max.1 gyermek részére (ára:1500 Ft/fő/éj) 14 évig. A szobában kényelmes ágyak,prakrtikus bútorok,fotel,asztal, székek,külön olvasólámpák és falifogas van továbbá minden szobában külön TV van több mint 60 csatornával.Fürdő-Wc tartozik az apartmanhoz fürdőszobaszekrénnyel,mosdóval, zuhanyzóval, toalettpapírt,kézmosót,Wc fertőtlenítőt, ágyneműt és személyenként 2 db törölközőt adunk. A tetőtéri 1 fős (ára: 6900 Ft/fő/éj) vagy 2 fős (ára 3750 Ft/fő/éj) egyéni klímás apartmanok a Jankó Apartmanház utcai épületében találhatók és közös nagyméretű fedett terasz,valamint utcára néző erkély tartozik a 4 db apartmanhoz külön asztalokkal,székekkel. További felszereltségük ugyanaz mint a többi apartmané. Zalakarosról Zalakomár felé kiépített kerékpárúton érhető el a kápolnapusztai bivalyrezervátum (8 km),mely fontos szerepet játszik a faj fennmaradásában, génállományának megőrzésében.A Kis-Balaton déli partja mentén érjük el a Kányavári-Szigetet (12 km),melynek tanösvényén lehet bejárni és kilátójából megfigyelni a tájvédelmi körzet madárvilágát,egyéb természeti szépségeit. Zalakaros-Behiákpusztán (1 km) lehetőség van lovaglásra,kezdőknek futószáron,haladóknak lovardában és tereplovaglásra gyönyörű környezetben.Sétakocsikázás,hegyi pincés esték és évente díjugrató versenyek gazdagítják a programot.Tengerünk a Balatonˇ~25 km.-re Hévíz és a műemlékekben gazdag Keszthely ~30 km.-re,Nagykanizsa~18 km.-re, Szlovénia és a Horvát határátkelő ~50 km.-re,a megyeszékhely Zalaegerszeg 60 km.-re van tőlünk. Horgászatot kedvelőknek a galamboki horgásztó (2 km),a miháldi horgásztó (8 km),Kis-Balaton déli oldalán a Kányavári-Sziget,északi oldalán a zalavári út melletti rész (15 km) nyújt lehetőséget a kikapcsolódásra.Zalakaroson a helyi utazási irodákban országon belüli és a közeli országokba szervezett különféle 1 napos utazási programokra lehet befizetni. Zalakarosra könnyű eljutni az M7-es autópálya zalakomári lehajtóját elhagyva a 71-es uton Zalakomáron keresztül, vagy a 71-es úton továbbhaladva Galambokon keresztül. Vonattal érkező vendégeinknek célszerű Zalakomárban leszállni és menetrend szerint köz

Feladva: 2018-03-29 17:16:39    

Címkék, kulcsszavak: üdülőhelygyógy-élményfürdőapartmanok

Eladó Zalakaroson egy jól működő,ismert apartmanház-panzió. A két épületből álló tehermentes családi ház 998 m2 telken,egy hr. számon épült és fizetővendéglátás-szállás céljára kialakítva működik. A ~540 m2 lakóterületen 20 ap.-szoba van,ebből 10 pótágyazható, 16 fürdő-wc,16 konyha van,a szállás egész területén kiépített a Wi-Fi. Az udvarban 40 m2-es fedett pavilon van és parkoló a gépkocsiknak. Az utcai épület pinceszintjén 35 m2-es szolgáltatóhelyiség van nagy ... további részletek >>

konyhával,mosdóval,wc-vel,továbbá egy 7 m2-es tároló gázkazánnal. A szakaszolható radiátoros fűtést és melegvizet gázkazán bíztosítja. Pinceszinten található egy különbejáratú 10 m2-es kamra mosdóval. Földszinten belső szobából nyíló,külső feljárós nagy utcai erkély van. Az épület földszintjén benyítva szépen berendezett fogadótér található tölgyfa ülőgarnitúrával,további asztalokkal,székekkel reggelíztetés céljára,ami egy étkezőasztalos nagy amerikai konyhában folytatódik. A fogadótérből előszobába jutva 4 db különbejáratú szoba és 2 db zuhanyzós fürdő-wc található,a nagyobbik fürdőszobában kád is van. Udvari lépcsőn az emeletre érve 29 m2-es fedett teraszt találunk,majd a folyosóról 4 db 2 fős tetőtéri apartman és 4.5 m2-es erkély nyílik. Az apartmanokban kábel Tv,klíma,fürdő-wc és konyha van hűtővel. Az udvari kétszintes új épületben szintenként 4 db 2 fős egyszobás és 1 db 4 fős,kétszobás apartman van,mindenhol egyéni erkéllyel.Minden apartmanban fürdő-wc,konyha van hűtővel, szobánként kábel Tv-vel. A szakaszolható radiátoros fűtést és melegvizet gázkazán bíztosítja. Földszinten kazánház,emeleten ágyneműtároló van,mérete 2.1-2.1 m2. Az épület padlástér járófelülete lefedett,hatalmas tárolóterületet ad. A városcentrum 500 m.-re van,az Európa hírű Gránit gyógy-termál és élményfürdő ~800 m.-re van,a sármelléki repülőtér~15 km.-re van,az M7-es autópálya lehajtó ~7 km.-re, a Balaton ~25 km.-re van tőlünk. Mi,a tulajdonos házaspár átadjuk vevőnek vendégkörünk és buszos partnereink listáját,az előfoglalásokat,több évtizedes tapasztalatunkat. A két ház teljes felszerelését,bútorzatát kínáljuk eladásra,a főszezon kezdetéig még nagyon kedvező áron,gyors beköltözéssel 99 mft.-ért. Többgenerációs család számára is bíztos megélhetés,jó befektetés. A nemzetközi és hazai foglalóoldalakon ismertségünk jól látható.; T: 003693340581; M: 0036302173272

Feladva: 2018-03-29 16:19:30    

Címkék, kulcsszavak: üdülőhelygyógyfürdőpanzió

Székesfehérváron használt Bútorok, háztartási gépek ELADÓK! Székesfehérváron Eladóak használtan de megkímélt állapotba az alábbi Bútorok illetve kiegészítők! 1./FranciaÁgy. Hibája: A rugója elszakadt, kissé kopott,van egy ici-pici szakadása, de javítható! Előnye: Nagyon kényelmes, nincs rajta süppedés, kemény kényelmes felületű! /Ajándék hozzá egy méretre szabott gumis lepedő!/ 10.000 Ft. 2./ ÍrÓasztal. Szétszedhetős. 3Fiókos plussz, plussz egy kulcsra zárhatós fiók! Szép tiszta ... további részletek >>

felület! 10.000 Ft. 3./ Egy hibátlan Üvegasztalka. Karc mentes üveg felülettel! 10.000 Ft. 4./ Két darab Fa FonatÚ Fotel párnáival, és egy két személyes sarok Fotel ugyancsak párnáival. 12.000 Ft. 5./ Tefal Konyhai RobotgÉp Tökéletesen működő, dobozával egyébb papírokkal. 6.500 Ft. 6./ Zanussi DWS 4704 MosogatÓgÉp Használt de szép tiszta kívűl belűl csak Firelés Lakásba! (Ami azt jelenti,hogy 2000év előtt épült Lakásokba való!)Mi már régóta nem használtuk,mert másikat vettünk! 15.000 Ft. 7./ FanyelŰ KÉskÉszlet FatartÓban Használt. 1.200 Ft. 8./ És egy szép tiszta Íróasztal szék! 7.000 Ft. 9./ ÉS EGY DARAB. ASZTALI SZáMíTóGéP. Intel Celeron Proceszorral, 0,5 Gbyte RAM, Windows XP SP3, A videón látható részletes paraméterekkel eladó! Egyébb jellemzôk: PS/2 Billentyûzet és egér, 4.db.USB, VGA, LAN, audió, párhuzamos és soros port, CD- író, Flopy meghajtó. /Kérje a videó felvételt is rólla! Ha érdekli! // Víruskeresô, Böngészô. 8.000 Ft. 10./ Relax Fotel Szék. Tökéletes masszív állapotba, csak egy kis hibája van, a huzatja egy pici részen el van szakadva. De lehet rá varrni, vagy venni egy másikat! Egy nehéz nap után tökéletes pihenést biztosít! 6.500 Ft. Szállítást nem tudom megoldani! E-mail cím: További képekért illetve kérdésekre e-mailban válaszolok! Cakk- Pakk az Öszes! Mert van több is nézz körül nállam! ÁR Egyben : 80.000 Ft.

Feladva: 2018-03-25 15:53:49    

Számítástechnikai szerviz Pécsen a Lánc utcai rendelõnél. Nyomtatók, notebook és asztali számítógépek javítása. Új számítógép összeszerelése az Ön igényei szerint! Megbízható utángyártott nyomtató kellékanyagok jó árban. Vállalkozások, cégek teljeskörû kiszolgálása kellékanyag kiszállítással, számítógépes hálózat építéssel, nyomtató karbantartással. Wifi eszközök és tanácsadás. ESET vírusirtó forgalmazása. HP DesignJet plotterek javítása helyszínen. Cím: Pécs, Farkas István utca 8. ... további részletek >>

Könnyû parkolási lehetõség! Telefon: 72/538-072 Hívjon még ma! Nyitva hétfõtõl csütörtökig: 9-tõl 17 óráig, pénteken: 15 óráig.

Feladva: 2018-03-01 15:56:03    

Eladó a képen látható intarziás dohányzó asztal. Méretek: 55x110x55 cm.
A hirdetés részletei >>

Feladva: 2018-02-23 14:48:25    

Minőségi csomoros nyárfa kertibútorok, rusztikus étkező garnitúrák a gyártótól kedvező áron készletből kiválaszthatók, vagy tetszés szerinti méretben és színben megrendelhetők. 8-10 személyes garnitúra (1 asztal max. 240 x 90cm , 2 pad) 1050 Euro, 10-12 személyes garnitúra (1 aztal, 2 pad, 2 karosszék) 1600 Euro Nádtetős garnitúra 2 m x 3,25 m (kb. 6-8 személyes) 1500 Euro. Tel: +36209325853 Akciók a weblapunkon:< /a> info@
A hirdetés részletei >>

Feladva: 2018-02-23 14:03:48    

Címkék, kulcsszavak: nádtetőskiülőkertigarnitúrafaétkező

KÜLFÖLDI MUNKÁK CSALÓDOTT SZAKEMBEREKNEK! Franciaországba: Hegesztőket keresünk minősítéssel AZONNAL! nyelvtudás nélkül. Tudni kell: ISO rajzot olvasni és röntgen minőségben hegeszteni. Fizetés: 14-16 EURÓ/ÓRA/ NETTÓ! Szállást adják! Németországba: AZONNAL! 4-5 fős klinkeres csapatot, szerszámokkal, autóval. Nyelvtudás nem kell, szállást adják. Elszámolás magyar bejelentett állás és alapbér + nm-ben 20 EURÓ/ NM – ami teljesítménytől függően emelkedhet. Légtechnikai szerelőket, ... további részletek >>

MÁR MOST IS gyakorlattal szaktudással kezdő fizetés 2000 EURÓ + szállás. A kinti szállás és munkahely közötti úti költséget térítik. Kiutazás önköltséges. Németországba folyamatosan: fenti szakmákban, illetve villanyszerelőket, víz-gáz-fűtés szerelőket. Valamint vasbeton szerelőket, zsaluzókat és segédmunkásokat is keresnek. Franciaországba még folyamatosan a következő szakmákban keresnek folyamatosan: - festő mázoló - gipszkartonozó - külső hőszigetelő-dryvitos - hidegburkoló - meleg burkoló - betonzsaluzó ács - homlokzati festő - tetőszigetelő –kátrányos vagy lindab - tetőfedő –cserepezés, kapcsos pala - szalagozó-bandázsoló - parkettázó - linóleumos –hegesztős is - targonca és gépkezelő - csontozó - raklap összeszerelő - hegesztő –minősítéssel - lakatos - csőszerelő - villanyszerelő - vízszerelő - asztalos Fizetés átlagosan 11-12 EURÓ/ÓRA/ NETTÓ kivétel a hegesztők akik 14-16 EURÓ/ÓRA/NETTÓ. Szállást adják! SEGÍTSÉGKÉNT ÖNÉLETRAJZ KÉSZÍTŐ LINK: Jelentkezni : VALINKA / J. E. KATALIN / ADÓSZÁM: HU53670308 06 70 616 3238 06 32 780 542

Feladva: 2018-02-21 16:06:18    

Koponyás asztali hamutartók most akár 60%-os kedvezménnyel a Lili Bizsu webáruházban Több mint 1000 féle ékszer és divatkiegészítő nagyszerű árakon óriási ( akár 80%-os ) kedvezménnyel egy helyen
A hirdetés részletei >>

Feladva: 2018-02-05 12:15:50    

Címkék, kulcsszavak: koponya hamutartóhalálfejes hamuskoponya netenonline koponyakoponyás ajándékhalálfejes dísztárgyolcsó koponyaasztali dísztárgy

Halálfejes koponya asztali hamutartók Most több mint 60%-os kedvezménnyel Akciós áron már 550Ft-tól Emellett több mint 1000 féle ékszer és divatkiegészítő nagyszerű áron óriási kedvezményekkel
A hirdetés részletei >>

Feladva: 2018-02-04 17:53:51    

Címkék, kulcsszavak: koponya hamutartóhalálfejes hamutartókoponyás hamushalálfejes hamushamutartó netenonline koponyahamutartó webáruházakciós koponyakoponya ajándékhalálfejes dísztárgy

MUNKAERŐKÖZVETÍTÉS 17 ÉV GYAKORLATTAL ! 17 éve vagyok sikeres munkaerő, munka, ingatlan s egyéb közvetítő . Jelenleg is 2 országba közvetítek hivatalosan, számlaképesen dolgozókat. Jelenleg is rengeteg a jelentkezőm, minden területen szakmákkal, vagy gyakorlattal – nem csak a jelenlegi közvetítéseimre jelentkeznek - , és sok pár menne bármerre együtt dolgozni. Keresek olyan cégeket, ahová a nálam jelentkezőknek lenne munka . Csak külsős vagy partneri szerződéssel dolgozom. Nálam ... további részletek >>

a 17 éves múltam végett a következőkre jelentkeznek: - építőipar minden területe ( festő, kartonos, burkoló, parkettás, dryvitos, asztalos, nyílászáró beépítő, ács, zsaluzó ács, tetőfedő, homlokzati festő - vakoló, épületburkoló, szalagozó, bandázsoló, linóleumos..stb ) - targoncás és gépkezelők - darukezelők - ipari alpinista - hegesztők, lakatosok - villanyszerelők - vízszerelők - csőszerelők - csontozó, húsfeldolgozó - csirkefeldolgozó - raktáros - komissiózó - sofőr - takarító-takarítónő - gyerekfelügyelők - idősgondozók - mosogató - segédmunkás vagy betanított munkás - gyári munkákra dolgozók - párok - stb… Üdvözlettel : Munkaerő - Franciaország és más eus országba - , munka és befektetések befektetők közvetítése Üzleti partnerek, üzletek közvetítése, szervezés, ügyintézés. Jónás-Erdész Katalin Közvetítő Tel.: +36 70 616 3238 +36 32 780 542

Feladva: 2018-02-03 12:17:16    

MUNKAERŐKÖZVETÍTÉS 17 ÉV GYAKORLATTAL ! 17 éve vagyok sikeres munkaerő, munka, ingatlan s egyéb közvetítő . Jelenleg is 2 országba közvetítek hivatalosan, számlaképesen dolgozókat. Jelenleg is rengeteg a jelentkezőm, minden területen szakmákkal, vagy gyakorlattal – nem csak a jelenlegi közvetítéseimre jelentkeznek - , és sok pár menne bármerre együtt dolgozni. Keresek olyan cégeket, ahová a nálam jelentkezőknek lenne munka . Csak külsős vagy partneri szerződéssel dolgozom. Nálam ... további részletek >>

a 17 éves múltam végett a következőkre jelentkeznek: - építőipar minden területe ( festő, kartonos, burkoló, parkettás, dryvitos, asztalos, nyílászáró beépítő, ács, zsaluzó ács, tetőfedő, homlokzati festő - vakoló, épületburkoló, szalagozó, bandázsoló, linóleumos..stb ) - targoncás és gépkezelők - darukezelők - ipari alpinista - hegesztők, lakatosok - villanyszerelők - vízszerelők - csőszerelők - csontozó, húsfeldolgozó - csirkefeldolgozó - raktáros - komissiózó - sofőr - takarító-takarítónő - gyerekfelügyelők - idősgondozók - mosogató - segédmunkás vagy betanított munkás - gyári munkákra dolgozók - párok - stb… Üdvözlettel : Munkaerő - Franciaország és más eus országba - , munka és befektetések befektetők közvetítése Üzleti partnerek, üzletek közvetítése, szervezés, ügyintézés. Jónás-Erdész Katalin Közvetítő Tel.: +36 70 616 3238 +36 32 780 542

Feladva: 2018-02-03 12:16:17    

Székszoknya bérlése esküvőre, eljegyzésre, ünnepi alkalmakra. A székszoknya szabásminta alapján varrt (nem lepelszerű), így nem csúszik le a székről. Vasalva, készre varrt masnikkal a bérlési ára 300/db. Ugyanitt asztalszoknya is bérelhető. 4,5 méter/db. Pécs, Siklós vonzáskörzet.
A hirdetés részletei >>

Feladva: 2018-01-10 11:07:11    

ASTER-RR Greenhouses & Plant b.v. Növényházak tervezése, kivitelezése szakterületén. 1988 óta Holland , Dán , Német, Angol gyártókkal és szakemberekkel közösen végzünk üvegházak, fóliaházak, forgalmazását és szereléseit szerte a világban több mint 40 országban . Közép és Dél Európában főként a Balkánon, Magyarországon, Romániában, Szerbiában, Makedóniában stb. és ez által a jó hírnevéhez tartozik, hogy nevezetes cégekkel együttműködve célunk a „kulcsrakész“ projektek ... további részletek >>

megvalósítása, másrészt, a magas fokú technológiák leszállítása a megrendelőknek. Termék kínálataink: - Venlo üvegházak teljes választéka (ÚJAK és BONTOTT de teljesen felújított üvegházak) - modern nagy légterű fólia házak és klasszikus BI-TUNEL és TUNEL fóliaházak házak , - belső berendezések: energia ernyők több típusban, fűtés technika Johnsson , Honeyweel rendszerekkel, klasszikus és felszívatós termesztő asztalok,magvető és cserepező gépek, stb - Venlo üvegházak hűtése: új technológia amely nyári nagy melegben oldal és végfal kereszt szellőzések lehetőségeit biztosítja , télen pedig rendkívül jó oldalfal hőszigetelés !! - rendkívüli kínálatunk: bontott de teljesen fel újított Venlo üvegházak rendkívül jó áron ! - Magas képzettségű és motivált szerelő csapatainkkal ezen rendszereket kulcsra készre szereljük. Bármilyen esetleges kérdése lenne , szívesen állunk az Ön rendelkezésére, egyben örömünkre szolgál árajánlatot tenni a termék kinálatainkról. Küldjön E-mail levelet : vagy telefonon: + 381 69 321 3 321

Feladva: 2018-01-09 19:44:03    

Egyedi konyhabútorok, térelválasztók, beépített szekrények gyártása Kerti bútorok, filagóriák, előtetők, növényfuttatók -Teraszok, faházak, kocsi beállók készítése Ilkó Sándor 06703110395
A hirdetés részletei >>

Feladva: 2018-01-07 18:56:37    

Számítástechnikai szerviz Pécsen a Lánc utcai rendelőnél. Nyomtatók, notebook és asztali számítógépek javítása. Új számítógép összeszerelése az Ön igényei szerint! Megbízható utángyártott nyomtató kellékanyagok jó árban. Vállalkozások, cégek teljeskörű kiszolgálása kellékanyag kiszállítással, számítógépes hálózat építéssel, nyomtató karbantartással. Wifi eszközök és tanácsadás. ESET vírusirtó forgalmazása. HP DesignJet plotterek javítása helyszínen. Cím: Pécs, Farkas István utca ... további részletek >>

8. Könnyű parkolási lehetőség! Telefon: 72/538-072 Hívjon még ma! Nyitva hétfőtől csütörtökig: 9-től 17 óráig, pénteken: 15 óráig.

Feladva: 2017-11-23 16:20:39    

Címkék, kulcsszavak: nyomtató szervizszámítógép javításnyomtató javításdesignjethpcanonsamsung

Üdvözlöm Kedves Hölgyem/Uram! Vállaljuk székelykapuk, kopjafák, dombormüvek., tornácok, ács és asztalos munkák készítését, minőségi munkával, kedvező áron igényeseknek. A fafaragást, hagyományőrzést, székelyterméket, a mi feladataink közé tartozik garanciálisan elkészíteni. Az alábbi holapon találnak képeket, amit hamarosan fogunk bővíteni, különböző mintájú képekkel. Igyekszünk rövid videokat is feltölteni a honlapra, ezzel egy kis betekintést nyújtani a munkáinkba. Elérhetőségeink: ... további részletek >> Tel. 0040748277518 Skype jakab.gyula7 Várjuk az igényes rendeléseiket határok nélkül, legfőbb erényünk a minőség mellett kompromisszum kötés az ügyfeleinkkel.

Feladva: 2017-11-17 20:20:56    

Címkék, kulcsszavak: Székelykapukkopjafákfafaragásfaragott bölcsőhagyományőrzésszékelytermékdombormüvek.tornácokács és asztalos munkák.

Partnercégünk részére keresünk munkatársakat Ausztria és Németország határmenti területeire az alábbi munkakörökbe: Asztalos vagy Bútorasztalos Awi tartályhegesztő Co hegesztő + lakatos Csarnoképítő/ Lemezszerelő Fémipari csiszoló Fényező (Jármű) Hagyományos esztergályos Lakatos, segéd Porfestő Villanyszerelő CNC élhajlító CNC esztergályos - programozó CNC Heidenhain programozó és gépkezelő CNC köszörűs / Schleifer CNC marós egyedi gyártás CNC marós gépbeállító CNC marós ... további részletek >>

programozó CNC Zayer Portálmarós Amit ajánlunk: Első kiutazás térítése, Ingyenes szállás Eurós kereset (magyar bejelentés, kiküldetés) Elvárás: munkakörnek megfelelő végzettség nem kell - A1 - B2 nyelvtudás Bővebb információ: +36 70 197 5293 (Visszahívom!) Jelentkezés:

Feladva: 2017-11-16 22:44:40    

Partnercégünk részére keresünk munkatársakat Ausztria és Németország határmenti területeire az alábbi munkakörökbe: Asztalos vagy Bútorasztalos Awi tartályhegesztő Co hegesztő + lakatos Csarnoképítő/ Lemezszerelő Fémipari csiszoló Fényező (Jármű) Hagyományos esztergályos Lakatos, segéd Porfestő Villanyszerelő CNC élhajlító CNC esztergályos - programozó CNC Heidenhain programozó és gépkezelő CNC köszörűs / Schleifer CNC marós egyedi gyártás CNC marós gépbeállító CNC marós ... további részletek >>

programozó CNC Zayer Portálmarós Amit ajánlunk: Első kiutazás térítése, Ingyenes szállás Eurós kereset (magyar bejelentés, kiküldetés) Elvárás: munkakörnek megfelelő végzettség nem kell - A1 - B2 nyelvtudás Bővebb információ: +36 70 197 5293 (Visszahívom!) Jelentkezés:

Feladva: 2017-11-16 22:34:05    

Partnercégünk részére keresünk munkatársakat Ausztria és Németország határmenti területeire az alábbi munkakörökbe: Asztalos vagy Bútorasztalos Awi tartályhegesztő Co hegesztő + lakatos Csarnoképítő/ Lemezszerelő Fémipari csiszoló Fényező (Jármű) Hagyományos esztergályos Lakatos, segéd Porfestő Villanyszerelő CNC élhajlító CNC esztergályos - programozó CNC Heidenhain programozó és gépkezelő CNC köszörűs / Schleifer CNC marós egyedi gyártás CNC marós gépbeállító CNC marós ... további részletek >>

programozó CNC Zayer Portálmarós Amit ajánlunk: Első kiutazás térítése, Ingyenes szállás Eurós kereset (magyar bejelentés, kiküldetés) Elvárás: munkakörnek megfelelő végzettség nem kell - A1 - B2 nyelvtudás Bővebb információ: +36 70 197 5293 (Visszahívom!) Jelentkezés:

Feladva: 2017-11-16 22:24:54    

Címkék, kulcsszavak: külföldi munkahegesztőlakatosCNC

Számítástechnikai szerviz Pécsen a Lánc utcai rendelőnél. Nyomtatók, notebook és asztali számítógépek javítása. Új számítógép összeszerelése az Ön igényei szerint! Megbízható utángyártott nyomtató kellékanyagok jó árban. Vállalkozások, cégek teljeskörű kiszolgálása kellékanyag kiszállítással, számítógépes hálózat építéssel, nyomtató karbantartással. Wifi eszközök és tanácsadás. ESET vírusirtó forgalmazása. HP DesignJet plotterek javítása helyszínen. Cím: Pécs, Farkas István ... további részletek >>

utca 8. Könnyű parkolási lehetőség! Telefon: 72/538-072 Hívjon még ma! Nyitva hétfőtől csütörtökig: 9-től 17 óráig, pénteken: 15 óráig.

Feladva: 2017-11-14 12:18:19    

Címkék, kulcsszavak: nyomtató szervizszámítógép javításnyomtató javításdesignjethpcanonsamsung

Mindennemű régiség felvásárlása azonnali készpénz fizetéssel: antik bútor, festmény, szőnyeg, szobor (fa, bronz), óra,(kar, asztali és fali álló), ezüst tárgy, (gyertyatartó, cukordoboz, tálca, evőeszköz, hiányos is) porcelán (Herendi, Zsolnay, Meissen) arany ékszer (fél drága, drágaköves, törtarany is), csillár (asztali, álló, fali lámpa) zongora, régi tv, rádió, bélyeg, kitüntetés, képeslap, írógép, varrógép!Lakásokat, házakat hagyatékkal együtt is megvásárolunk!Cim: BP.1137. SZENT ISTVÁN KRT. ... további részletek >>


Feladva: 2017-09-22 21:56:19    

Mindennemű régiség felvásárlása azonnali készpénz fizetéssel: antik bútor, festmény, szőnyeg, szobor (fa, bronz), óra,(kar, asztali és fali álló), ezüst tárgy, (gyertyatartó, cukordoboz, tálca, evőeszköz, hiányos is) porcelán (Herendi, Zsolnay, Meissen) arany ékszer (fél drága, drágaköves, törtarany is), csillár (asztali, álló, fali lámpa) zongora, régi tv, rádió, bélyeg, kitüntetés, képeslap, írógép, varrógép!Lakásokat, házakat hagyatékkal együtt is megvásárolunk!Cim: BP.1137. SZENT ISTVÁN KRT. ... további részletek >>


Feladva: 2017-09-22 16:18:09    

Ausztriai és németországi munkára keresek szakembereket. (Néhány esetben nem kell, de a legtöbb esetben valamennyi nyelvtudás szükséges.) Bővebb információ, érdeklődés a e-mail címen vagy a 0670 197 5293-as telefonszámon. Betöltendő munkakörök: Autogén csőhegesztők / Asztalos / AWI-CO hegesztő-lakatos / Betonelem gyártó / CNC élhajlító / CNC Esztergályos / CNC Heidenhain programozó / CNC köszörűs (Schleifer) / CNC maró gépbeállító / CNC marós gépkezelő / CNC ... további részletek >>

marós programozó / CNC Trumpf élhajlító gépkezelő / CNC Trumpf lézergépkezelő / CNC Zayer Portálmarós / Co hegesztő + lakatos / Fémszerkezet szerelő / Kapcsolószekrény szerelő / Lakatos, hegesztő / Lézergépkezelő Magyar bejelentés, külföldi kiküldetés.

Feladva: 2017-09-16 17:58:53    

Ausztriai és németországi munkára keresek szakembereket. (Néhány esetben nem kell, de a legtöbb esetben valamennyi nyelvtudás szükséges.) Bővebb információ, érdeklődés a e-mail címen vagy a 0670 197 5293-as telefonszámon. Betöltendő munkakörök: Autogén csőhegesztők / Asztalos / AWI-CO hegesztő-lakatos / Betonelem gyártó / CNC élhajlító / CNC Esztergályos / CNC Heidenhain programozó / CNC köszörűs (Schleifer) / CNC maró gépbeállító / CNC marós gépkezelő / CNC ... további részletek >>

marós programozó / CNC Trumpf élhajlító gépkezelő / CNC Trumpf lézergépkezelő / CNC Zayer Portálmarós / Co hegesztő + lakatos / Fémszerkezet szerelő / Kapcsolószekrény szerelő / Lakatos, hegesztő / Lézergépkezelő Magyar bejelentés, külföldi kiküldetés.

Feladva: 2017-09-16 17:52:54    

Címkék, kulcsszavak: külföldi munkahegesztőlakatosCNC

Hölgyeim, Uraim! Engedjék meg, hogy fegyelmükbe ajánljam ezt az új építésű lakást, melynek LEGYEN Ön az első új tulajdonosa. Először is hadd vezessem körbe leendő otthonában. Kezdjük hát körutazásunkat. Miután be jöttünk a kapun és kényelmesen le parkoltunk a házunk előtt a saját parkolónkba már csak néhány lépést s bent is vagyunk a lakásunkban. Itt egy kényelmes elő térben találjuk magunkat, ahol kényelmesen le vehetjük a cipőket és kabátokat. Balra fordulva találjuk a lépcsőt, amin kicsit ... további részletek >>

később a felső szintre fogunk fel menni. A lépcső mellett találunk egy kicsi tárolót ahol akár a kabátokat tárolhatjuk. Forduljunk jobbra ahol egy másik ajtó található ahol is a háztartási gépeknek adhatunk otthont. Majd tovább haladva egyenesen egy tágas Amerikai konyhás nappaliban találhatjuk magunkat. Itt van elég hely, hogy kényelmesen tudjunk sütni, főzni, sőt egy étkező asztal is kényelmesen elfér. Innen nyílik továbbá egy kisebb terasz is ahol igazán remekül élvezhetjük a reggeli adta ébredés idejét. Hiszen fontos, hogy jól induljon a napunk. De nézzük meg a felső szintet is ahol az éjszakánkét töltjük. Itt a felső szinten három kényelmes szoba található, amit kényünk kedvünk szerint használunk. Mind A három szoba világos és tágas is. Így kényelmesen tudjuk elhelyezni a bútorainkat. Ami elengedhetetlen a tökéletes pihenéshez. Tetszett? Nézzük meg személyesen is.

Feladva: 2017-09-12 18:12:15    

Kárpitozott bútorokat gyártó cég asztalost keres felvételre azonnali kezdéssel jó kereseti lehetőséggel. Tel:0620 9799018 Budapest 18.ker. Péterhalmi u. 8
A hirdetés részletei >>

Feladva: 2017-09-11 12:28:45    

Címkék, kulcsszavak: Asztalos

XI. kerületben lévő ingatlanirodánkba keresünk agilis, pozitív természetű értékesítő kollégákat. Elvárások: - min. 1-2 éves értékesítői tapasztalat (ingatlanközvetítésben szerzett tapasztalat előny) - kiemelkedő kommunikációs készség - határozott megjelenés - jó csapatjátékos Amit nyújtunk: - kimagasló jutalék - többféle bevételi lehetőség - amennyiben az értékesítő kolléga szeretne élni a lehetőséggel, úgy call center által egyeztetett időpontok a saját portfólió felépítéséhez és ... további részletek >>

fenntartásához - fiatalos csapat - irodavezetői támogatás - piacvezető hirdetéskezelési támogatások - szakmai képzések Feladatok: - banki és piaci ingatlanok értékesítése - hirdetések felrakása - ügyfelek kezelése - irodai és területi munka Ami nálunk nincsen: - nincs asztalpénz - nincs semmilyen költség, 0 ft-tal lehet kezdeni dolgozni - nincs oktatási költség - nincs ügyeleti rendszer Amennyiben felkeltettük érdeklődését, úgy várjuk jelentkezését a 06 20 313 8510-es telefonszámon.

Feladva: 2017-09-09 19:28:01    

Kerti bútorok akác rönkfából, Játszótéri bútorok, eszközök, -minősítve is-, továbbá, egyéb Kiegészítők gyártása és forgalmazása. Ezen belül: Akác és fenyő rönk asztalok, székek, padok, hinták, fotelok, kanapék, szaletlik, buszmegállók, dísz kutak, tornyos játékok csúszdával, hintával, hidak gyermekjátékok, stb. Különböző méretekben és kivitelben. Egyéni igényeket is kielégítünk. Termékeinket házhoz szállítjuk és telepítjük. 80 féle, ill. méretű termékünket megtekintheti a weboldalun
A hirdetés részletei >>

Feladva: 2017-08-26 10:20:58    

Eladó, Bonanza variálható (bővíthető) étkezőasztal 6 db székkel. Színe: Cseresznye Az asztal lábai kicsavarhatóak. Mérete összecsukva: 120x80cm. Kinyitva: 217x80cm Magassága :78cm. Hat db. karfás szék tartozik hozzá
A hirdetés részletei >>

Feladva: 2017-08-22 13:11:06    

Gravírozott Gránit Táblák , Panasonic Normál papíros Fax, Pingpong asztal , Nevada akkumulátor töltő eladó!
A hirdetés részletei >>

Feladva: 2017-08-11 08:00:47    

Gravírozott Gránit lapok, Panasonic fax, Pingpong asztal, Nevada Akkumulátor töltő Garanciás Eladó%
A hirdetés részletei >>

Feladva: 2017-08-11 07:44:34    

Minőségi csomoros nyárfa kertibútorok, rusztikus étkező garnitúrák a gyártótól kedvező áron készletből kiválaszthatók, vagy tetszés szerinti méretben és színben megrendelhetők. 8-10 személyes garnitúra (1 asztal max. 240 x 90cm , 2 pad) 1050 Euro, 10-12 személyes garnitúra (1 aztal, 2 pad, 2 karosszék) 1600 Euro Nádtetős garnitúra 2 m x 3,25 m (kb. 6-8 személyes) 1500 Euro. Tel: +36209325853 Akciók a weblapunkon:< /a> info@
A hirdetés részletei >>

Feladva: 2017-08-09 12:20:03    

Címkék, kulcsszavak: kertibútorfabútorfa kerti garnitúrapavilontetős kiülő

Freddy V. 3 elemes szekrénysor, Zala Bútor termék, asztallal /kétajtós szekrény, bárszekrény, üvegajtós szekrény/ ágyneműtartóval, komóddal eladó.
A hirdetés részletei >>

Feladva: 2017-07-30 16:34:09    

Áron alul Eladó VOLVO 440-es személykocsi. mercedes 123-as alktrészek még szélvédő is gumival .autógumi. szerelési utmutató . ajtó . ablak . mozsdó .wc,csaptelepek, lucnik varrógép .interlock, hifi.touner. háztartási gépek ,gyümölcscentriguga,kukoricapattogtató,számitógép alkatrészek, sarokkanapé,gyerekheverő, felnőt ágy , matrac . lemezjátszó, kerti szék asztal napernyő,szőllőprés,hibás kazán, hibás kapáógép , kontack hibás degitális fényképezőgép de retro holmik is vannak . napozóágy . ... további részletek >>

és sok minden más árban megegyezünk . t 06307301509

Feladva: 2017-07-21 19:19:05    

Áron alul Eladó VOLVO 440-es személykocsi. mercedes 123-as alktrészek még szélvédő is gumival .autógumi. szerelési utmutató . ajtó . ablak . mozsdó .wc,csaptelepek, lucnik varrógép .interlock, hifi.touner. háztartási gépek ,gyümölcscentriguga,kukoricapattogtató,számitógép alkatrészek, sarokkanapé,gyerekheverő, felnőt ágy , matrac . lemezjátszó, kerti szék asztal napernyő,szőllőprés,hibás kazán, hibás kapáógép , kontack hibás degitális fényképezőgép de retro holmik is vannak . napozóágy . ... további részletek >>

és sok minden más árban megegyezünk . t 06307301509

Feladva: 2017-07-21 18:32:43    

Szállodai munkák Pennsylvániában és Floridában. (szobák takarítására, párok jelentkezését is várjuk) Keresünk 4 fő asztalost és egy fő karbantartót. További munkalehetőségek: Floridában. Áruházak járófelületének tisztítása, felületkezelése, ablakok mosása. Házvezetőnői és bejárónői munkák. New York Bővebben és jelentkezés e -mailben, vagy telefonon itt: A kiutazáshoz teljes körű ügyintézést vállalunk : Repülőjegy, szállás,és a ... további részletek >>

kiutazáshoz szükséges dokumentumok beszerzése,továbbá felkészítés az utazásra. Telefonszám megadása esetén, természetesen felhívjuk Önt ! Jelentkezés e -mailben, vagy telefonon itt: Amennyiben további kérdése van, az alábbi elérhetőségeken megteheti : Telefon:70 401 0882 Víberen is

Feladva: 2017-07-07 18:53:13    

Címkék, kulcsszavak: Amerikában dolgozni

Számlaképes vállalkozó Családi házak generál kivitelezését vállaljuk az ország egész területén. Hagyományos és könnyű szerkezetes házak egyaránt. Kiváló Ács és kőműves szakemberekkel. Ingyenes árajánlat! Kőművesmunkáinkat alaptól kéményig elvégezzük alvállalkozók nélkül. Vállalunk - Kerítés építés - Drótkerítés építés - Gipszkartonozás, gipszkarton álmennyezetek, előtétfalak- Családi ház építés, felújítás, bővítés - Kőműves kivitelezés - Generálkivitelezés - Homlokzati hőszigetelés ... további részletek >>

- Vályog épületek felújítása, helyreállítása - Ács szerkezetek, tető készítése, cserépfedés - Tetőfedés - Aszfaltozás - Alapozási munkák (sík és mély alapozás) - Lakatos munkák, acélszerkezetek - Asztalos ipari termékek gyártása - Vakolási munkák, vékony vakolatok, színvakolatok - Kézi - gépi földmunka - Villanyszerelési munkák - Burkolási munkák - Nyílászárók elhelyezése - Kőműves munkák - Vízvezeték szerelés - Vasbeton szerkezetek készítése - Generál kivitelezés - Térbeton - Betonacél szerelés - Betonburkolat - Festés, Mázolás, Tapétázás - Színezés ( vékony vakolat ) - Kerítés építés - Drótkerítés építés - Gipszkartonozás, gipszkarton álmennyezetek, előtétfalak - lakásfelújítás - tetőtér beépítés - hőszigetelés - Szobafestés - Tisztasági festés - Homlokzat festés - Lapos tetők szigetelés - Kémény építés - Kerítés építés - Falazás - Betonozás - Partfal és támfal építés

Feladva: 2017-07-06 23:58:48    

Szállodai munkák Pennsylvániában és Floridában (szobák takarítására, párok jelentkezését is várjuk) Keresünk 4 fő asztalost és 1 fő karbantartót. További munkalehetőségek: Florida. Áruházak járófelületének tisztítása, felületkezelése, ablakok és parkolók mosása. Házvezetőnői és bejárónői munkák. New York Bővebben és jelentkezés e -mailben, vagy telefonon itt: A kiutazáshoz teljes körű ügyintézést vállalunk : Repülőjegy, szállás,és a kiutazáshoz ... további részletek >>

szükséges dokumentumok beszerzése,továbbá felkészítés az utazásra. Szükség van egy érvényes útlevélre, fényképes önéletrajzra, valamint egy személyes találkozásra, előre egyeztetett időpontban. Telefonszám megadása esetén, természetesen felhívjuk Önt ! Jelentkezés e -mailben, vagy telefonon itt: Amennyiben további kérdése van, az alábbi elérhetőségeken megteheti : Telefon:70 401 0882 Víberen is E-mail:

Feladva: 2017-07-04 22:48:45    

Címkék, kulcsszavak: Amerikában dolgozni

Szállodai munkák Pennsylvániában és Floridában (szobák takarítására, párok jelentkezését is várjuk) Keresünk 4 fő asztalost és 1 fő karbantartót. További munkalehetőségek: Florida. Áruházak járófelületének tisztítása, felületkezelése, ablakok és parkolók mosása. Házvezetőnői és bejárónői munkák. New York Bővebben és jelentkezés e -mailben, vagy telefonon itt: A kiutazáshoz teljes körű ügyintézést vállalunk : Repülőjegy, szállás,és a kiutazáshoz ... további részletek >>

szükséges dokumentumok beszerzése,továbbá felkészítés az utazásra. Szükség van egy érvényes útlevélre, fényképes önéletrajzra, valamint egy személyes találkozásra, előre egyeztetett időpontban. Telefonszám megadása esetén, természetesen felhívjuk Önt ! Jelentkezés e -mailben, vagy telefonon itt: Amennyiben további kérdése van, az alábbi elérhetőségeken megteheti : Telefon:70 401 0882 Víberen is E-mail:

Feladva: 2017-07-04 22:48:10    

Freddy V. 3 elemes szekrénysor, Zala Bútor termék, asztallal /kétajtós szekrény, bárszekrény, üvegajtós szekrény/ ágyneműtartóval, komóddal eladó.
A hirdetés részletei >>

Feladva: 2017-07-02 16:31:48    

Szállodai munkák Pennsylvániában és Floridában (szobák takarítására párok jelentkezését is várjuk) Keresünk 4 fő asztalost és 2 fő karbantartót. További munkalehetőségek:( Florida) Áruházak járófelületének tisztítása, felületkezelése, ablakmosás, parkolók mosása. Házvezetőnői és bejárónői munkák. (New York) Bővebben és jelentkezés e -mailben, vagy telefonon itt: A kiutazáshoz teljes körű ügyintézést vállalunk : Repülőjegy, szállás,és a ... további részletek >>

kiutazáshoz szükséges dokumentumok beszerzése,továbbá felkészítés az utazásra. Telefonszám megadása esetén, természetesen felhívjuk Önt ! Jelentkezés e -mailben, vagy telefonon itt: Amennyiben további kérdése van, az alábbi elérhetőségeken megteheti : Telefon:70 401 0882 Víberen is

Feladva: 2017-06-30 16:43:29    

Szállodai munkák Pennsylvániában és Floridában (szobák takarítására párok jelentkezését is várjuk) Keresünk 4 fő asztalost és 1 fő karbantartót. További munkalehetőségek: (Florida) Áruházak járófelületének tisztítása, felületkezelése, ablakmosás, parkolók mosása. Házvezetőnői és bejárónői munkák. (New York) Bővebben és jelentkezés e -mailben, vagy telefonon itt: A kiutazáshoz teljes körű ügyintézést vállalunk : Repülőjegy, szállás,és a ... további részletek >>

kiutazáshoz szükséges dokumentumok beszerzése,továbbá felkészítés az utazásra. Telefonszám megadása esetén, természetesen felhívjuk Önt ! Jelentkezés e -mailben, vagy telefonon itt: Amennyiben további kérdése van, az alábbi elérhetőségeken megteheti : Telefon:70 401 0882 Víberen is

Feladva: 2017-06-27 17:45:59    

Titok! Most kiderül! … - Olyan ez a hely, mint Tante Marie családjának valamikori vendéglője Pesten – Mesélte rendszerint a Bajszos, aki a mesék szerint már akkoriban is ismerte Tante Mariet. Csakhát akkor még gyerekek voltak, de együtt zavarócskáztak a Csikos Oroszlán asztali között Pesten -. Lehet, hogy nem Csikos Oroszlán volt, de valami hasonló. A fene egye meg, felejt az ember. De a lényeg, hogy annak a helynek is hangulata volt. Mint a Tante Marie Tavernesnek. Ilyennek kell ... további részletek >>

lenni egy igazi vendéglőnek. Olyannak, ahol az ember jól érzi magát…

Feladva: 2017-06-06 11:48:01    

Dél-Németországi munkahelyre, Ulm környékére keresünk: Asztalos kollégát Feladat: Fa Ajtók- Ablakok gyártása, majd beépítése. Elvárás: Asztalos végzettség v. gyakorlat Amit kínálunk: Szakmai fejlődési lehetőség Igény esetén szállás biztosított Túlórázási lehetőség Német bejelentett munkaviszony Önéletrajzokat a 📮 e-mail címre várjuk ☎️0049/1512-638-9661
A hirdetés részletei >>

Feladva: 2017-06-06 10:54:01    

Dél-Németországi munkahelyre, Ulm környékére keresünk: Asztalos kollégát Feladat: Fa Ajtók- Ablakok gyártása, majd beépítése. Elvárás: Asztalos végzettség v. gyakorlat Amit kínálunk: Szakmai fejlődési lehetőség Igény esetén szállás biztosított Túlórázási lehetőség Német bejelentett munkaviszony Önéletrajzokat a 📮 e-mail címre várjuk ☎️0049/1512-638-9661
A hirdetés részletei >>

Feladva: 2017-06-01 15:50:12    

Ácsot, asztalost, villanyszerelőt, homlokzat szigetelőt, gipszkartonost és kőművest keresünk. Azonnali indulással kedvező munkakörülményekkel. Jelentkezni kizárólag e-mailben fényképes önéletrajzzal. Néhány órán belül felvesszük Önnel a kapcsolatot.
A hirdetés részletei >>

Feladva: 2017-04-27 13:36:46    

Címkék, kulcsszavak: AusztriaNémetországÉpítőipar

Ácsot, asztalost, villanyszerelőt, homlokzat szigetelőt, gipszkartonost és kőművest keresünk. Azonnali indulással kedvező munkakörülményekkel. Jelentkezni kizárólag e-mailben fényképes önéletrajzzal. Néhány órán belül felvesszük Önnel a kapcsolatot.
A hirdetés részletei >>

Feladva: 2017-04-27 13:34:34    

Címkék, kulcsszavak: AusztriaNémetországÉpítőipar

Látogasson el Veresegyházra 2017. június 30 - július 2. között /3 nap/ a Mézesvölgyi Általános Iskolába /Mogyoródi u.5-7./ Vasútmodell Kiállítás lesz. 153 méter hosszú modul terepasztalunkon sok érdekesség, mozgó figurák. Idén 170 éves a Pest-Cegléd-Szolnok vasútvonal. Ebből az alkalomból új asztalrészletünk Ó-Szolnok állomás a Tisza parton. Bővebb információ honlapunkon: Baranyai János Vasútbarát és Modellező Klub
A hirdetés részletei >>

Feladva: 2017-04-26 15:48:58    

Címkék, kulcsszavak: vasútmodellkiállítás

Látogasson el Veresegyházra 2017. június 30 - július 2. között /3 nap/ a Mézesvölgyi Általános Iskolába /Mogyoródi u.5-7./ Vasútmodell Kiállítás lesz. 153 méter hosszú modul terepasztalunkon sok érdekesség, mozgó figurák. Idén 170 éves a Pest-Cegléd-Szolnok vasútvonal. Ebből az alkalomból új asztalrészletünk Ó-Szolnok állomás a Tisza parton. Bővebb információ honlapunkon: Baranyai János Vasútbarát és Modellező Klub
A hirdetés részletei >>

Feladva: 2017-04-26 15:41:52    

Címkék, kulcsszavak: modellvasútkiállítás

Gravograph IS-400 gravírgép eladó! Szoftverrel, számítógéppel, satus befogóval, marótűkkel. Munkaterület: 305mm X 210mm Gravograph IS-800 (NewHermes V-9200) eladó. T-nútos asztal, forgácselszívó és hűtőfolyadék előkészítés, 635mm X 495mm munkaterület, felületkövető egység, szoftverek, kifogástalan gyári állapot! Tel:(30) 4858-999
A hirdetés részletei >>

Feladva: 2017-04-10 13:10:21    

Címkék, kulcsszavak: gravírozó gép cnc gravograph

Elhelyezkednék álltalános karbantartóként,gondokként több szakmában szerzet kiemelkedő tapasztalattal(gipszkarton szerelő,festő-mázoló,hideg búrkoló,allap viz és alap villany szerelés) asztalos szakmával.Jelenleg dolgozom hívásokat este 19-után vagy hétvégén egész nap tudok fogadni.
A hirdetés részletei >>

Feladva: 2017-04-09 09:50:04    

Címkék, kulcsszavak: Karbantartógondnok

HÚSVÉTI FALUSI HÉTVÉGE AZ X-GAMES HOTELBEN! Szállás 2 fő részére a választott szobatípusban, félpanziós ellátással: 80.900 Ft helyett MOST 50.980,- Ft/3 éj/2 fő Érkezéskor: welcome drink, gyerekeknek csoki nyuszi, szobákban húsvéti meglepetéssel! Program ízelítő: szombaton húsvéti karaoke buli, egész hétvégén húsvéti gyermekprogramok (csoki tojás-keresés az udvaron, nyuszi-, bari-simogató, tojásfestés, arcfestés, stb.) Wellness szolgáltatások használata (finn- és infraszauna, sószoba, ... további részletek >>

jacuzzi használat) Sportszolgáltatások használata (ping-pong, billiárd, darts, íjászat, asztali hoki) Rendelkezésre áll: korlátlan wifi, ingyenes zárt parkoló, hűtő, TV, hajszárító, gyermek játszóház, játszótér Településen idegenforgalmi adót nem kell fizetni. Késői kijelentkezés 13.00-kor. Térítéssel igénybe vehető szolgáltatásaink: masszázs; szombaton buszos kirándulás a környék nevezetességeihez 5000,-/fő; vasárnap kirándulás az ópusztaszeri skanzenbe 5000,-/fő; gyerekeknek póni lovaglás. Felhasználható: 2017. április 14-től – 2017. április 17-ig - 4nap /3éjszaka Gyerek kedvezmény: 1. gyerek 0-3 éves korig ingyenes, 2. gyerek 0-6 éves korig 50% Érdeklődjön vagy foglaljon azonnal a +3670-514-11-02-es telefonszámon vagy írjon nekünk az címre! jelige: "LAST MINUTE HÚSVÉT!"

Feladva: 2017-04-06 16:27:26    

Címkék, kulcsszavak: pihenéswellneskirándulásvidékhúsvétkirándulásgyeremekgyermekprogramokaktív pihenéstiszafolyó

Eladó lángos és pecsenyesütő berendezés aztallal együtt, a berendezés 2 lángos. A tepsi mély, tehát akár lángost vagy pecsenyét, vagy akár fánkot is süthet benne. Gázreduktorral együtt. Szükség esetén adok hozzá palackot is.
A hirdetés részletei >>

Feladva: 2017-03-26 07:41:47    

Címkék, kulcsszavak: sütőberendezéslángospecsenyebüfé

Minőségi csomoros nyárfa kertibútorok, rusztikus étkező garnitúrák a gyártótól kedvező áron készletből kiválaszthatók, vagy tetszés szerinti méretben és színben megrendelhetők. 8-10 személyes garnitúra (1 asztal max. 240 x 90cm , 2 pad) 1050 Euro, 10-12 személyes garnitúra (1 aztal, 2 pad, 2 karosszék) 1600 Euro Nádtetős garnitúra 2 m x 3,25 m (kb. 6-8 személyes) 1500 Euro. Tel: +36209325853 Akciók a weblapunkon:< /a> info@
A hirdetés részletei >>

Feladva: 2017-03-15 14:47:31    

Címkék, kulcsszavak: kerti bútorkerti garnitúrafabútorcsomoros nyár bútorétkezőgarnitúraétkezőbútor

Minőségi csomoros nyárfa kertibútorok, rusztikus étkező garnitúrák a gyártótól kedvező áron készletből kiválaszthatók, vagy tetszés szerinti méretben és színben megrendelhetők. 8-10 személyes garnitúra (1 asztal max. 240 x 90cm , 2 pad) 1050 Euro, 10-12 személyes garnitúra (1 aztal, 2 pad, 2 karosszék) 1600 Euro Nádtetős garnitúra 2 m x 3,25 m (kb. 6-8 személyes) 1500 Euro. Tel: +36209325853 Akciók a weblapunkon:< /a> info@
A hirdetés részletei >>

Feladva: 2017-03-15 14:25:49    

Címkék, kulcsszavak: kerti bútorkerti garnitúrafabútorcsomoros nyár bútorétkezőgarnitúraétkezőbútor

Minőségi csomoros nyárfa kertibútorok, rusztikus étkező garnitúrák a gyártótól kedvező áron készletből kiválaszthatók, vagy tetszés szerinti méretben és színben megrendelhetők. 8-10 személyes garnitúra (1 asztal max. 240 x 90cm , 2 pad) 1050 Euro, 10-12 személyes garnitúra (1 aztal, 2 pad, 2 karosszék) 1600 Euro Nádtetős garnitúra 2 m x 3,25 m (kb. 6-8 személyes) 1500 Euro. Tel: +36209325853 Akciók a weblapunkon:< /a> info@
A hirdetés részletei >>

Feladva: 2017-03-15 13:34:26    

Címkék, kulcsszavak: kerti bútorkerti garnitúrafabútorcsomoros nyár bútorétkezőgarnitúraétkezőbútor

Kazán lemez 5mm-es2db,Alu lemez 1mm-es,Rostélypállca 25,35,45,cm-esek,Katonai távcső szállkeresztes,Sóder rosta,Fünyiró házi készitésű,Teraszkorlát kóvállcsotvas 5x2m-es,Flájmó fünyiró motor,Hegesztő pajzs,Panel elektroda,Asztalos fürészkeret,3”-os Patentfógó,Furógép állvány,Mozgás érzékelő,Trapéz alu lemez 200x50cm-es10db,Tésztagép 6 darabos,Hirsman anterna erősitő,Hintaágy keret,I és U gerendák 2m-esek,Lábszelep réz 5/4”-os,Tüzoltó tömlő,Hogász asztal 4db székel,Kakukkos órák 2db ... további részletek >>

orosz,Papagájkalitka kicsi 2db,Uszó és Alkony kapcsoló,Bontot szarufák 3db 4m-es,Soskuti mészkőtégla 30db,Nagy villás és körmös kulcsok,Kávédaráló kicsi,Tolómérök,Jamina cserép 200db új,Pacsirta,Terta és egyéb öreg rádiók,Gólyos csap 5/4”-os 2db,Benzines láncfürész Alkó,Zsiros bödön kicsi 2db,Patent fogó 3”-os,Lakatos talpas derékszög nagy,Diófarönk 2m-es,Gáz és Oxigén reduktor új,Menetfurok és metszök 3/8”-3/4”-ig,Hunnia varógép,Poclen munkagéphez elektromos panelek,Bomerpánt 10cm-es 4db,Menetes csőcsonk 3/8”-6/4”-ig,Horganyzot cső 6/4”-os 4db 3m-es,Kőmüves állvány hosz 250cm széleség 80cm magaság250cm-es patent öszeszerelés magasitható,Grundfosz nyomáskapcsoló,Philips kazetás magnó deck toronyba való gyüri a szalagot,Kézi lemezolló,Szobatermosztát 2db,Olajlevállasztó,Jézus az Olajfák hegyén goblen 60x90cm-es,Olajfékes ajtó csukó,Mozgás érzékelő,BEAG fülhalgató,Flálymó fünyiró motor,Hajdu kerek mosógéphez motórok 3db,csapágy,kondenzátor,ékszijtárcsa,RosszTV cserének,Holánc UAZ méret,Hoki korcsolya 42-es,Vasfürész keret,Rozsdamentes lemezek,2x2cm-es 70 cm zártszelvény 70db,Vaslétra 3m-es,Magnó kazeták 50ft db,Ifjúsági magazin,Világ ifjuság,Magyar ifjúság,Ezermester,Sportoj velünk,380-asDugaljak és Aljzatok,Hangszorók 120-as2db 200-as 2db,Telefonok Tárcsások Nyomógombosak,Szimens mobiltelefon üzemképes,Gumikerék tőmör fix forgó 20cm-es,Gombasapka,Forasztó páka,Autó pumpák,Tányékészlet 6db-os alföldi porcelán,Festet tányérok és csuprok,Nagy zégerfogó Poclen munkagéphez,800 DB Könyv,STB !

Feladva: 2017-02-22 14:20:50    

Kazán lemez 5mm-es2db,Alu lemez 1mm-es,Rostélypállca 25,35,45,cm-esek,Katonai távcső szállkeresztes,Sóder rosta,Fünyiró házi készitésű,Teraszkorlát kóvállcsotvas 5x2m-es,Flájmó fünyiró motor,Hegesztő pajzs,Panel elektroda,Asztalos fürészkeret,3”-os Patentfógó,Furógép állvány,Mozgás érzékelő,Trapéz alu lemez 200x50cm-es10db,Tésztagép 6 darabos,Hirsman anterna erősitő,Hintaágy keret,I és U gerendák 2m-esek,Lábszelep réz 5/4”-os,Tüzoltó tömlő,Hogász asztal 4db székel,Kakukkos órák 2db ... további részletek >>

orosz,Papagájkalitka kicsi 2db,Uszó és Alkony kapcsoló,Bontot szarufák 3db 4m-es,Soskuti mészkőtégla 30db,Nagy villás és körmös kulcsok,Kávédaráló kicsi,Tolómérök,Jamina cserép 200db új,Pacsirta,Terta és egyéb öreg rádiók,Gólyos csap 5/4”-os 2db,Benzines láncfürész Alkó,Zsiros bödön kicsi 2db,Patent fogó 3”-os,Lakatos talpas derékszög nagy,Diófarönk 2m-es,Gáz és Oxigén reduktor új,Menetfurok és metszök 3/8”-3/4”-ig,Hunnia varógép,Poclen munkagéphez elektromos panelek,Bomerpánt 10cm-es 4db,Menetes csőcsonk 3/8”-6/4”-ig,Horganyzot cső 6/4”-os 4db 3m-es,Kőmüves állvány hosz 250cm széleség 80cm magaság250cm-es patent öszeszerelés magasitható,Grundfosz nyomáskapcsoló,Philips kazetás magnó deck toronyba való gyüri a szalagot,Kézi lemezolló,Szobatermosztát 2db,Olajlevállasztó,Jézus az Olajfák hegyén goblen 60x90cm-es,Olajfékes ajtó csukó,Mozgás érzékelő,BEAG fülhalgató,Flálymó fünyiró motor,Hajdu kerek mosógéphez motórok 3db,csapágy,kondenzátor,ékszijtárcsa,RosszTV cserének,Holánc UAZ méret,Hoki korcsolya 42-es,Vasfürész keret,Rozsdamentes lemezek,2x2cm-es 70 cm zártszelvény 70db,Vaslétra 3m-es,Magnó kazeták 50ft db,Ifjúsági magazin,Világ ifjuság,Magyar ifjúság,Ezermester,Sportoj velünk,380-asDugaljak és Aljzatok,Hangszorók 120-as2db 200-as 2db,Telefonok Tárcsások Nyomógombosak,Szimens mobiltelefon üzemképes,Gumikerék tőmör fix forgó 20cm-es,Gombasapka,Forasztó páka,Autó pumpák,Tányékészlet 6db-os alföldi porcelán,Festet tányérok és csuprok,Nagy zégerfogó Poclen munkagéphez,800 DB Könyv,STB !

Feladva: 2017-02-22 14:13:32    

Kazán lemez 5mm-es2db,Alu lemez 1mm-es,Rostélypállca 25,35,45,cm-esek,Katonai távcső szállkeresztes,Sóder rosta,Fünyiró házi készitésű,Teraszkorlát kóvállcsotvas 5x2m-es,Flájmó fünyiró motor,Hegesztő pajzs,Panel elektroda,Asztalos fürészkeret,3”-os Patentfógó,Furógép állvány,Mozgás érzékelő,Trapéz alu lemez 200x50cm-es10db,Tésztagép 6 darabos,Hirsman anterna erősitő,Hintaágy keret,I és U gerendák 2m-esek,Lábszelep réz 5/4”-os,Tüzoltó tömlő,Hogász asztal 4db székel,Kakukkos órák 2db ... további részletek >>

orosz,Papagájkalitka kicsi 2db,Uszó és Alkony kapcsoló,Bontot szarufák 3db 4m-es,Soskuti mészkőtégla 30db,Nagy villás és körmös kulcsok,Kávédaráló kicsi,Tolómérök,Jamina cserép 200db új,Pacsirta,Terta és egyéb öreg rádiók,Gólyos csap 5/4”-os 2db,Benzines láncfürész Alkó,Zsiros bödön kicsi 2db,Patent fogó 3”-os,Lakatos talpas derékszög nagy,Diófarönk 2m-es,Gáz és Oxigén reduktor új,Menetfurok és metszök 3/8”-3/4”-ig,Hunnia varógép,Poclen munkagéphez elektromos panelek,Bomerpánt 10cm-es 4db,Menetes csőcsonk 3/8”-6/4”-ig,Horganyzot cső 6/4”-os 4db 3m-es,Kőmüves állvány hosz 250cm széleség 80cm magaság250cm-es patent öszeszerelés magasitható,Grundfosz nyomáskapcsoló,Philips kazetás magnó deck toronyba való gyüri a szalagot,Kézi lemezolló,Szobatermosztát 2db,Olajlevállasztó,Jézus az Olajfák hegyén goblen 60x90cm-es,Olajfékes ajtó csukó,Mozgás érzékelő,BEAG fülhalgató,Flálymó fünyiró motor,Hajdu kerek mosógéphez motórok 3db,csapágy,kondenzátor,ékszijtárcsa,RosszTV cserének,Holánc UAZ méret,Hoki korcsolya 42-es,Vasfürész keret,Rozsdamentes lemezek,2x2cm-es 70 cm zártszelvény 70db,Vaslétra 3m-es,Magnó kazeták 50ft db,Ifjúsági magazin,Világ ifjuság,Magyar ifjúság,Ezermester,Sportoj velünk,380-asDugaljak és Aljzatok,Hangszorók 120-as2db 200-as 2db,Telefonok Tárcsások Nyomógombosak,Szimens mobiltelefon üzemképes,Gumikerék tőmör fix forgó 20cm-es,Gombasapka,Forasztó páka,Autó pumpák,Tányékészlet 6db-os alföldi porcelán,Festet tányérok és csuprok,Nagy zégerfogó Poclen munkagéphez,800 DB Könyv,STB !

Feladva: 2017-02-22 14:11:24    

Keresünk: asztalosokat,kőműveseket,szobafestő ket,nyílászáró beépítésben jártas szakembereket.
A hirdetés részletei >>

Feladva: 2017-02-16 14:03:48    

Címkék, kulcsszavak: ajtóablakbeépítés

Kerti RÖNKBÚTOROK, JÁTSZÓTÉRI BÚTOROK közvetlen a gyártótól. Házhozszállítás, telepítés. Termékeinket és a vonatkozó árainkat tekintse meg a weboldalon.
A hirdetés részletei >>

Feladva: 2017-02-03 18:03:51    

Címkék, kulcsszavak: fenyõ rönk asztalokszékekpadokhintákfotelokkanapékszaletlikbuszmegállókdísz kutaktornyos játékok csúszdávalhintával

Szeretné irodai asztalán saját cégének logójával nyomtatott bögréjét látni? Bögre nyomtatásban nincs számunkra lehetetlen. Egyedi bögre készítés akár grafikai tervezéssel együtt. Ön kitalálja, mi megvalósítjuk. Egyedi bögrék készítése már 550+ÁFA-tól. Keressen minket bizalommal, kollégáim készséggel állnak rendelkezésére. Ha kiváló minőségben szeretne bögrét, keressen élérhetőségeink egyikén. Bögre nyomtatás weboldala: ... további részletek >>


Feladva: 2017-01-31 23:22:14    

Havi egy főzéssel a hónap minden napján meleg ételt varázsolni az asztalra, anélkül, hogy hosszú órákat töltenél minden nap a konyhában? Igen, lehetséges! Válaszokat, segítséget az oldalon találsz!
A hirdetés részletei >>

Feladva: 2017-01-20 08:02:36    

Kerti rönkfa asztalgarnitúrák nagy választékban eladók. Egyedi méretben és elképzelésének megfelelő kivitelben is vállaljuk a gyártást. Termékeink a weboldalon megtalálhatók.
A hirdetés részletei >>

Feladva: 2017-01-12 18:55:44    

Kiemelkedően magas áron vásárol galériánk: TÖRTARANY- FAZONARANY FOGARANYAT(fogal együt is átveszük) BRILLES ÉKSZEREKET BOROSTYÁN ÉKSZEREKET Festményt Bútort Fali,- asztali,-kar,- zsebórákat Bronz tárgyakat Herendit, ZSOLNAYT! Kovács Margit kerámiákat Ezüst tárgyakat Kitüntetést, képeslapot Régi pénzeket Antik bizsut! TELJES HAGYATÉKOT! KISZÁLÁS, ÉRTÉKBECSLÉS DÍJTALAN ! Büszkék vagyunk munkánkra,és arra, hogy sok ügyfelünk bizalmát nyertük el, akik újra és újra térnek ... további részletek >>

vissza hozzánk! Kérem hívjon bizalommal a nap bármely szakán! 06303328551

Feladva: 2017-01-12 17:17:54    

Címkék, kulcsszavak: Kézpénzes felvásárlás

Üdvözlöm Kedves Hölgyem/Uram! Vállaljuk székelykapuk, kopjafák, dombormüvek., tornácok, ács és asztalos munkák készítését, minőségi munkával, kedvező áron igényeseknek. A fafaragást, hagyományőrzést, székelyterméket, a mi feladataink közé tartozik garanciálisan elkészíteni. Az alábbi holapon találnak képeket, amit hamarosan fogunk bővíteni, különböző mintájú képekkel. Igyekszünk rövid videokat is feltölteni a honlapra, ezzel egy kis betekintést nyújtani a munkáinkba. Elérhetőségeink: ... további részletek >> Tel. 0040748277518 Skype jakab.gyula7 Várjuk az igényes rendeléseiket határok nélkül, legfőbb erényünk a minőség mellett kompromisszum kötés az ügyfeleinkkel.

Feladva: 2017-01-10 21:05:23    

Címkék, kulcsszavak: Székelykapukkopjafákfafaragáshagyományőrzésszékelytermékdombormüvek.tornácokács és asztalos munkák.

ASTER-RR Greenhouses & Plant b.v. Növényházak tervezése, kivitelezése szakterületén. 1988 óta Holland , Dán , Német, Angol gyártókkal és szakemberekkel közösen végzünk üvegházak, fóliaházak, forgalmazását és szereléseit szerte a világban több mint 40 országban . Közép és Dél Európában főként a Balkánon, Magyarországon, Romániában, Szerbiában, Makedóniában stb. és ez által a jó hírnevéhez tartozik, hogy nevezetes cégekkel együttműködve célunk a „kulcsrakész“ projektek ... további részletek >>

megvalósítása, másrészt, a magas fokú technológiák leszállítása a megrendelőknek. Termék kínálataink: - Venlo üvegházak teljes választéka (ÚJAK és BONTOTT de teljesen felújított üvegházak) - modern nagy légterű fólia házak és klasszikus BI-TUNEL és TUNEL fóliaházak házak , - belső berendezések: energia ernyők több típusban, fűtés technika Johnsson , Honeyweel rendszerekkel, klasszikus és felszívatós termesztő asztalok,magvető és cserepező gépek, stb - Venlo üvegházak hűtése: új technológia amely nyári nagy melegben oldal és végfal kereszt szellőzések lehetőségeit biztosítja , télen pedig rendkívül jó oldalfal hőszigetelés !! - rendkívüli kínálatunk: bontott de teljesen fel újított Venlo üvegházak rendkívül jó áron ! - Magas képzettségű és motivált szerelő csapatainkkal ezen rendszereket kulcsra készre szereljük. Bármilyen esetleges kérdése lenne , szívesen állunk az Ön rendelkezésére, egyben örömünkre szolgál árajánlatot tenni a termék kinálatainkról. Küldjön E-mail levelet : vagy telefonon: + 381 69 321 3 321

Feladva: 2017-01-08 13:45:11    

Címkék, kulcsszavak: üvegházak és fóliaházak

Eladó tökéletes állapotban lévő Touragoo etetőszék. Könnyen lepatentolható és mosható huzat, 14 kg.-ig használható, asztal része 3 állásba állítható, 3 pontos biztonsági öv, lábtartóval és alul praktikus tárolóval. Mintázata miatt fiúknak és lányoknak is egyaránt alkalmas. Összecsukható, kis helyen elfér. Brendonban vásárolt, új ára: 14.000.- Ft, eladási ára: 9.000.- Ft.
A hirdetés részletei >>

Feladva: 2017-01-08 00:07:55    

Csomorosnyar asztal Elado!!!
A hirdetés részletei >>

Feladva: 2016-12-29 16:02:54    

Vendéglátó ipari, gyári segédmunkára, keresünk nőket, férfiakat vagy párokat a következő munkakörökbe: - szállodai takarítót, szobalányt,mosogatókat,gyári raktári munkásokat,takarítás,csomagolás,épí tőiparba bádogosokat,festőket,asztalosokat.F ix kereset hosszútávú munka kinti bejelentéssel.Szállás étkezés biztosított ,német nyelvtudás nem szükséges.Érdeklődni kizárólag telefonon 06-30/389-4498 , 06-20/978-99-18
A hirdetés részletei >>

Feladva: 2016-12-23 08:58:47    

Vendéglátó ipari, gyári segédmunkára, keresünk nőket, férfiakat vagy párokat a következő munkakörökbe: - szállodai takarítót, szobalányt,mosogatókat,gyári raktári munkásokat,takarítás,csomagolás,épí tőiparba bádogosokat,festőket,asztalosokat.F ix kereset hosszútávú munka kinti bejelentéssel.Szállás étkezés biztosított ,német nyelvtudás nem szükséges.Érdeklődni kizárólag telefonon 06-30/389-4498 , 06-20/978-99-18
A hirdetés részletei >>

Feladva: 2016-12-22 11:14:13    

Vendéglátó ipari, gyári segédmunkára, keresünk nőket, férfiakat vagy párokat a következő munkakörökbe: - szállodai takarítót, szobalányt,mosogatókat,gyári raktári munkásokat,takarítás,csomagolás,épí tőiparba bádogosokat,festőket,asztalosokat.F ix kereset hosszútávú munka kinti bejelentéssel.Szállás étkezés biztosított ,német nyelvtudás nem szükséges.Érdeklődni kizárólag telefonon 06-30/389-4498 , 06-20/978-99-18
A hirdetés részletei >>

Feladva: 2016-12-22 11:10:12    

Vendéglátó ipari, gyári segédmunkára, keresünk nőket, férfiakat vagy párokat a következő munkakörökbe: - szállodai takarítót, szobalányt,mosogatókat,gyári raktári munkásokat,takarítás,csomagolás,épí tőiparba bádogosokat,festőket,asztalosokat.F ix kereset hosszútávú munka kinti bejelentéssel.Szállás étkezés biztosított ,német nyelvtudás nem szükséges.Érdeklődni kizárólag telefonon 06-30/389-4498 , 06-20/978-99-18
A hirdetés részletei >>

Feladva: 2016-12-22 09:48:31    

Vendéglátó ipari, gyári segédmunkára, keresünk nőket, férfiakat vagy párokat a következő munkakörökbe: - szállodai takarítót, szobalányt,mosogatókat,gyári raktári munkásokat,takarítás,csomagolás,épí tőiparba bádogosokat,festőket,asztalosokat.F ix kereset hosszútávú munka kinti bejelentéssel.Szállás étkezés biztosított ,német nyelvtudás nem szükséges.Érdeklődni kizárólag telefonon 06-30/389-4498 , 06-20/978-99-18
A hirdetés részletei >>

Feladva: 2016-12-22 09:45:44    

Vendéglátó ipari, gyári segédmunkára, keresünk nőket, férfiakat vagy párokat a következő munkakörökbe: - szállodai takarítót, szobalányt,mosogatókat,gyári raktári munkásokat,takarítás,csomagolás,épí tőiparba bádogosokat,festőket,asztalosokat.F ix kereset hosszútávú munka kinti bejelentéssel.Szállás étkezés biztosított ,német nyelvtudás nem szükséges.Érdeklődni kizárólag telefonon 06-30/389-4498 , 06-20/978-99-18
A hirdetés részletei >>

Feladva: 2016-12-22 09:30:39    

6 személyes kinyitható cseresznye színű étkező asztal eladó !!
A hirdetés részletei >>

Feladva: 2016-12-06 22:53:17    

Szilveszterezz a Cziffra Szalon & bárban! Szilveszter napján 20. órától jelmezes zenés partyval búcsúztattjuk az ó évet! Fergeteges GATSBY hangulatban különleges ízesítésű forralt borrral, Cziffra koktéllal /csak nálunk kapható/ várunk minden kedves vendéget!Élőzenés show műsorral szórakoztatja a vendégeket Petrovics Regina- Dj P. és Balázs János .Kétféle menü ajánlatunk: ”A”menű: Sajttal sonkával töltött-rántott palacsinta Milánói sertés szelet csemege uborka 1 pohár ... további részletek >>

forralt bor 1 pohár pezsgő /2590.Ft/ ”B” menű: Kaszinó tojás Rántott sajt vegyes körettel tartár mártás 1 pohár forralt bor 1 pohár pezsgő /2590.Ft/ Asztalfoglalás: 06317811064

Feladva: 2016-12-05 16:20:28    

Címkék, kulcsszavak: Cziffrabalázsjánosbuliszilveszter

Budapesten induló Asztalos OKJ-s tanfolyamot kerestél, de eddig egyik iskola sem nyerte el a tetszésedet? Most van egy nagyon jó hírünk: nálunk az Asztalos szakmát már 10 hónap alatt kitanulhatod, ráadásul gyakorlati helyet is biztosítunk. Ha szeretsz egyedi dolgokat készíteni és szívesen dolgoznál az építőiparban, akkor ennél jobb szakmát nem is találhatnál magadnak. Dolgozz Asztalosként, és váljon belőled megbízható szakember! Minden évben több időpontban indulnak az Asztalos tanfolyamok, így ... további részletek >>

biztosan találsz magadnak megfelelőt. Jelentkezz minél hamarabb, nehogy elkapkodják előled a helyeket:

Feladva: 2016-11-24 19:56:35    

Érdekelnek az egyedi tervezésű épületek? Szívesen dolgoznál az építőiparban és lennél asztalos vagy gépkezelő? Jó a kézügyességed és Rád lehetne bízni egy nagyobb gép kezelését is? Válassz a Budapesten induló építőipari tanfolyamaink közül, és légy Te a legjobb szakember a csapatban. Válassz hosszabb lefolyású OKJ-s tanfolyamot vagy pár nap alatt elvégezhető OKJ-n kívüli képzést! A Budapesten jelenleg induló építőipari tanfolyamokat a linkre kattintva tudod megtekinteni: ... további részletek >>

Feladva: 2016-11-24 17:51:12    

Rusztikus kerti bútor, kerti garnitúra csomoros nyárfából eladó, tetszés szerinti méretekben és színekben a gyártótól megrendelhetõ! Garantált minõség, kedvezõ árak! Termékeink: asztalok, padok, székek, fatálak, sarokpadok, egyedi faragott bútorok, komplett kerti és étkezõ garnitúrák. Éttermek, vendéglátóegységek, borozók, sörözõk berendezését is vállaljuk. Tel: +36209325853 ; Web: ; info@
A hirdetés részletei >>

Feladva: 2016-11-14 12:07:14    

Címkék, kulcsszavak: kerti bútorkerti garnitúrapavilonfabútorfa kertibútor

Biokandalló gyártás, BIOKANDALLÓ forgalmazás. BIO KANDALLÓ AKCIÓ! BIOKANDALLÓ VÁSÁR! Falra szerelhető BIOKANDALLÓ, Falba építhető BIOKANDALLÓ, Körbeépíthető BIOKANDALLÓ. Sarokba szerelhető BIO KANDALLÓ Asztali BIOKANDALLÓ. BIO ETANOL, BIOETANOL forgalmazás. A BIOKANDALLÓK bio ETANOLLAL üzemeltethetőek. A rozsdamentes anyagból készült BIOKANDALLÓ égők hosszú élettartamot biztosítanak BIO KANDALLÓINKNAK. Minden biokandalló égő szabályozható teljesítményű, így az égési idő széles ... további részletek >>

tartományban változtatható. A biokandallók az égés folyamán csak vízpárát és egy nagyon kevés szén dioxidot termelnek, ami teljesen veszélytelen a szervezetre. A BIOKANDALLÓNAK NEM KELL kéményt építeni! Nincs CO MÉRGEZÉS VESZÉLY! A biokandalló használatánál csak szellőztetni kell, így pótolva a friss levegő utánpótlást. www.biokandalló.com

Feladva: 2016-11-11 11:13:43    

Címkék, kulcsszavak: Biokandalló gyártásBIOKANDALLÓ forgalmazás. BIO KANDALLÓ AKCIÓ! BIOKANDALLÓ VÁSÁR! Falra szerelhető BIOKANDALLÓFalba építhető BIOKANDALLÓKörbeépíthető BIOKANDALLÓ. Sarokba sz

Lenovó asztali számitógépek 7db eladók.10 000/db Duplamagos 160gb sata hdd 2gb ddr2 ram,használatra készenn vihető.Érdeklődni csak telefonon-06204284285
A hirdetés részletei >>

Feladva: 2016-11-06 21:07:38    

Önállóan dolgozni tudó asztalost keresek állandó munkára.
A hirdetés részletei >>

Feladva: 2016-11-03 20:49:52    

Önállóan dolgozni tudó asztalost keresek állandó munkára.
A hirdetés részletei >>

Feladva: 2016-11-03 20:47:37    

Üdvözlöm Kedves Hölgyem/Uram! Vállaljuk székelykapuk, kopjafák, dombormüvek., tornácok, ács és asztalos munkák készítését, minőségi munkával, kedvező áron igényeseknek. A fafaragás, hagyományőrzés, székelytermékek, a mi feladataink közé tartozik garanciálisan elvégezni, Az alábbi holapon találnak képeket, amit hamarosan fogunk bővíteni, különböző mintájú kapukkal. Igyekszünk rövid videokat is feltölteni a honlapra, ezzel egy kis betekintést engedni a munkáinkba. Elérhetőségeink: ... további részletek >> Tel. 0040748277518 Skype jakab.gyula7 Várjuk az igényes rendeléseiket határok nélkül, legfőbb erényünk a kompromisszum vállalása. Székelykapuk, kopjafák, fafaragás, hagyományőrzés, székelytermék, dombormüvek., tornácok, ács és aztalos munkák.

Feladva: 2016-10-18 20:45:11    

Cégünk vállalja karton és hullámkarton csomagolások gyártását, feliratozását, TFL és kimetszett dobozok gyártását, széles körű nyomdai szolgáltatásokat is kínálva: Névjegykártya, szórólap, címke, prospektus, könyv, nyomtatvány, plakát, levélpapír, nyomott boríték, mappa, stancolt dosszié, hullámkarton és karton csomagoló anyagok, húsipari csomagoló, szalvéta, toalett papír, papírtörlő, alkalmi kiadványok (esküvői meghívók, ültető kártyák, dombornyomott kiadványok stb.), idényjellegű nyomdai ... további részletek >>

termékek (egyedi céges üdvözlőlapok, asztali-, fali- és speditőr naptárak stb.) készítése megrendelőink kívánsága szerint. Keresse fel weboldalunkat és kérje személyre szabott árajánlatunkat:

Feladva: 2016-10-18 09:26:51    

Címkék, kulcsszavak: dobozkartonhullámkartonnyomda

Cégünk vállalja karton és hullámkarton csomagolások gyártását, feliratozását, TFL és kimetszett dobozok gyártását, széles körű nyomdai szolgáltatásokat is kínálva: Névjegykártya, szórólap, címke, prospektus, könyv, nyomtatvány, plakát, levélpapír, nyomott boríték, mappa, stancolt dosszié, hullámkarton és karton csomagoló anyagok, húsipari csomagoló, szalvéta, toalett papír, papírtörlő, alkalmi kiadványok (esküvői meghívók, ültető kártyák, dombornyomott kiadványok stb.), idényjellegű nyomdai ... további részletek >>

termékek (egyedi céges üdvözlőlapok, asztali-, fali- és speditőr naptárak stb.) készítése megrendelőink kívánsága szerint. Keresse fel weboldalunkat és kérje személyre szabott árajánlatunkat:

Feladva: 2016-10-18 09:25:11    

Címkék, kulcsszavak: kartonhullámkartonnyomdadoboz

VI.kerület BELSŐ-TERÉZVÁROSBAN a Révay utcában kínálok eladásra egy 50 m2-es, 1+2 szobás (amerikai konyhás nappali + 2 szobás) I.emeleti, udvari kilátású, világos,cirkófűtéses TELJES KÖRŰEN,IGÉNYESEN FELÚJÍTOTT,műszakilag és esztétikailag egyaránt igényesen, teljesen körűen felújított, beépített, gépesített, új konyhabútorral felszerelt, berendezett bútorokkal,kiegészítőkkel (ágyak,asztal,kanapé stb.) öröklakást, kívül-belül felújított polgári házban. Az ingatlan irányára: 44,9 Millió Ft ... további részletek >>

Az ár irányár, jöjjön nézze meg, tegyen ajánlatot.

Feladva: 2016-09-24 15:13:23    

A Pracht & Pracht Personal nagy múlttal rendelkező németközpontú és német tulajdonú személyügyi szolgáltató , mely több ezer munkavállalónak segített megtalálni képességeinek és elképzeléseinek legmegfelelőbb állást. Németországi partnercégünk megbízásából keresünk:.. Autoiparba laminalokat! Feladat : autoalkatreszek laminalasa Elsösorban autoiparban, autiopari gyartosoron szerzett tapasztalattal rendelkezök , illetve rokonszakmakban eltöltött ( pl asztalos-szerszamkeszitö....) ... további részletek >>

kezügyesseggel megaldott szakemberek jelentkezeset varjuk! Hely: Freiberg am Neckar Müszak: 3 ( szombat munkanap ) Ber: 10 € Brutto / ora Szallas igenyelhetö, utolag berböl levonva... Kezdes: azonnal. Nemet nyelvtudas beszed / iras szint elvart követelmeny! Erdeklödni:nemet nyelvü fenykepes öneletrajzal, telefonszammal, Email: Telefon: 4915118247991 , 4971416889586 lehet

Feladva: 2016-09-20 10:31:19    

Kiadó 180 m2-es volt üzlet. WC, klíma, 3 fázisú, teljes mérőórás közmű ellátással, fűtéssel a VIII. kerület Asztalos Sándor u. 5-6-ban. Üzletnek, varrodának, nagykernek is alkalmas. Ára: 800.-Ft/m2+Áfa/hó + rezsi. Kaució egyhavi nettó bérleti díj. Érdeklődni munkaidőben (08.00-16.00) a 06-20-429-63-09 telefonszámon lehet.
A hirdetés részletei >>

Feladva: 2016-09-06 15:07:58    

Nagymegyeri cég asztalost keres.
A hirdetés részletei >>

Feladva: 2016-09-06 09:40:35    

Eladó új tölgy kerti garnitúrák ! Asztal 150 cm hossz x 74 széles Pad 120 cm hossz ülőfelület plusz hozzá való székek ! A méretek és a székek padok darab száma megbeszélés alapján változtatható ! Számla van . Érdeklődni e- mailben vagy telefonon ! na Telsz 06 30 494 5233
A hirdetés részletei >>

Feladva: 2016-09-04 15:42:56    

Németh gyártmányu abrikter a felsö része a munka asztal az már nem gyári ugy lett csinálva rá de tökéletesen möködött sajnos igy találtam rá hogy a motor és a gyalu tengely kés hiányzott de ugye ami a lényeg az maga az asztal motor és tengelyt tenni bele nem olyan nagy költség....... aki ismeri tudja milyen masziv nehéz gépröl van szó biztos van vagy 300kg a munka pad 130cm hosszu és 38cm széles...... tehát ez müködött csak némi ráforditást igényel és remek gép lesz belöle az árban ... további részletek >>

megegyezünk.... de olyanok ne hivjanak hogy felének menyi a fele ...... aki ért hozzá az tudja mit ér....

Feladva: 2016-08-15 16:09:53    

Címkék, kulcsszavak: galaxy

Tulipános ágykeret! Méretre készítjük. A tulipános magas ágykeret (nem franciaágy magasságú). Fenyőből, bükkböl, juharból, tölgyből is készítjük a tulipános ágyakat. Tulipán paradicsom! A szép tulipánok kedvező árral párosulnak! Praktikusság és tartósság jellemzi. vagy Telefonon érdeklődjön az árakról. Mobil: 06-20-397-9102 vagy
A hirdetés részletei >>

Feladva: 2016-08-05 08:04:54    

Címkék, kulcsszavak: bútortulipánoshagyományosfábólpraktikuskézzel faragotttartósságkerti bútorlócaasztalszékfürdődézsastelázsikomódkiülőkNépi motívumokpadokkerti pavi

Tulipános lóca /pad, vizes pad / tömör bükkfából! A tulipános lócát készítjük még fenyőfából és tölgyfából is. A tulipános lócát egyedi méretek szerint készítjük! A tulipános lócák kézzel készülnek. A tulipános lócának minden része tömör fából készül . A szép tulipánok kedvező árral párosulnak! Praktikusság és tartósság jellemzi. vagy Telefonon érdeklődjön az árakról. Mobil: 06-20-397-9102 vagy
A hirdetés részletei >>

Feladva: 2016-08-04 08:48:05    

Címkék, kulcsszavak: bútortulipánoshagyományosfábólpraktikuskézzel faragotttartósságkerti bútorlócaasztalszékfürdődézsastelázsikomódkiülőkNépi motívumokpadokkerti pavi

Tömör túlipános székek bükkfából! A tulipános székek a megrendelő méretei szerint készülnek. A tulipános székek rendelhetők bükkfából, fenyőfából és tölgyfából is. A tulipánok kedvező árakkal párosulnak. Népi motívumokat tartalmaz. Praktikusság és tartósság jellemzi. vagy Telefonon érdeklődjön az árakról. Mobil: 06-20-397-9102 vagy
A hirdetés részletei >>

Feladva: 2016-08-03 08:01:37    

Címkék, kulcsszavak: bútortulipánoshagyományosfábólpraktikuskézzel faragotttartósságkerti bútorlócaasztalszékfürdődézsastelázsikomódkiülőkNépi motívumokpadokkerti pavi

Tulipános tömör fenyőfa bútorok! A tulipános fenyőfa bútorok, lóca, szék, amik kézzel készülnek. A tulipános bútorokat egyedi méretek szerint készítjük. A tulipánok kedvező árakkal párosulnak. Hagyományos bútorok, tömör fenyőfából készülnek. Népi motívumokat tartalmaz. Praktikusság és tartósság jellemzi. vagy Telefonon érdeklődjön az árakról. Mobil: 06-20-397-9102 vagy
A hirdetés részletei >>

Feladva: 2016-08-02 10:54:13    

Címkék, kulcsszavak: bútortulipánoshagyományosfábólpraktikuskézzel faragotttartósságkerti bútorlócaasztalszékfürdődézsastelázsikomódkiülőkNépi motívumokpadokkerti pavi

Eladnám újszerü világos számítógép asztalomat olcsóbban a félárnál. Mobilon, neten érdeklődhet.
A hirdetés részletei >>

Feladva: 2016-07-31 20:40:44    

Tulipános tömör fenyőfa bútorok! A tulipános fenyőfa bútorok, lóca, szék, amik kézzel készülnek. A tulipános bútorokat egyedi méretek szerint készítjük. A tulipánok kedvező árakkal párosulnak. Hagyományos bútorok, tömör fenyőfából készülnek. Népi motívumokat tartalmaz. Praktikusság és tartósság jellemzi. vagy Telefonon érdeklődjön az árakról. Mobil: 06-20-397-9102 vagy
A hirdetés részletei >>

Feladva: 2016-07-29 22:28:32    

Címkék, kulcsszavak: bútortulipánoshagyományosfábólpraktikuskézzel faragotttartósságkerti bútorlócaasztalszékfürdődézsastelázsikomódkiülőkNépi motívumokpadokkerti pavi

Tulipános komód (lisztes szekrény), íróasztal, tulipános ágy, tulipános karnis, tulipános ablak, tömör fenyőfából, bükkfából, tölgyfából. Egyedi méretek szerint! Tulipán minden mennyiségben! A tulipánok kedvező árakkal párosulnak ! Hagyományos bútor, fából készül. Népi motívumokat tartalmaz. Praktikusság és tartósság jellemzi. Telefonon érdeklődjön az árakról. Mobil: 06203979102
A hirdetés részletei >>

Feladva: 2016-07-28 10:34:30    

Címkék, kulcsszavak: bútortulipánoshagyományosfábólpraktikuskézzel faragotttartósságkerti bútorlócaasztalszékfürdődézsastelázsikomódkiülőkNépi motívumokpadokkerti pavi

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Az ágy teljes hossza:204,5cm, fekvő felület:194 cm Az ágy szélessége:106cm, fekvő szélesség 99cm A szekrény magassága: 180cm +a középen ... további részletek >>

elhelyezkedő faragott dísz magassága: 18cm szélessége: 125cm mélysége(belső tárolási méret):48cm A fésülködőasztal magassága:167cm szélessége:126cm mélysége:37cm

Feladva: 2016-07-18 08:45:44    

Antik Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Az ágy teljes hossza:204,5cm, fekvő felület:194 cm Az ágy szélessége:106cm, fekvő szélesség 99cm A szekrény magassága: 180cm +a ... további részletek >>

középen elhelyezkedő faragott dísz magassága: 18cm szélessége: 125cm mélysége(belső tárolási méret):48cm A fésülködőasztal magassága:167cm szélessége:126cm mélysége:37cm

Feladva: 2016-07-17 20:56:23    

sűrgősen eladó....2 bd gyerek bicikli,nagyméretü medence+ 2 db kissebb,2-db bukósisak motorosoknak.1-db gyerek bukó sisak új állapotban.szekrénysor jó állapotban.asztal,kihúzhtó 4-személyes heverő,kerti hinta,szerszámok.asztal,meg 4-szék ernyővel...
A hirdetés részletei >>

Feladva: 2016-07-16 19:19:55    

Székszoknya (csak szabott) bérlése 250,-ft/db. Néhány adat szolgáltatásainkról: 1200db SZÉKSZOKNYA (= min. 4 széktípusra, 3 színben), 8500db MASNI (=63 színből választhat), 16 féle masnimegkötési módszer, 1765m ASZTALI FUTÓ (= minden masnihoz a megfelelő), 125m ASZTALSZOKNYA, terítők és minden dekorkellék egy helyen. VIRÁGKÖTÉS a dekoratív stílustól a minimálig. 8 éve együtt alkotó, kreatív, vidám csapat fogadja a megrendeléseket. Megújult weboldalunk:
A hirdetés részletei >>

Feladva: 2016-07-13 19:06:57    

Címkék, kulcsszavak: székszoknya bérlésesküvői dekorációdekoratőrmenyasszonyi csokor

Kiadó 400 m2-es volt autószerviz. Szociális helyiségekkel (WC, fürdő), teljes mérőórás közmű ellátással, fűtéssel a VIII. kerület Asztalos Sándor u. 5-6-ban. Ára: 800.-Ft/m2+Áfa/hó + rezsi. Kaució háromhavi bérleti díj. Érdeklődni munkaidőben (08.00-16.00) a 06-20-429-63-09 telefonszámon lehet.
A hirdetés részletei >>

Feladva: 2016-06-30 12:32:41    

A Pracht GmbH. Üveges/ablakbeepitöket keres! Hely: Stuttgart Elvarasok: Nemet nyelvtudas Szakmai vegzettseg mint asztalos/ ablakbeepitö üvegezesi szakmai tapasztalattal, vagy Legalabb 5 eves szakmai tapasztalat mint üvegezö, ablakbeepitö. Ablak-vasalattipusok ismerete önallo munkavegzes B kat. jogositvany Nemet nyelvü öneletrajzat, vegzettseget igazolo dokumentumait anita.antal@pracht-person varom
A hirdetés részletei >>

Feladva: 2016-06-27 14:13:34    

A Pracht GmbH.ablakbeepitö szakembereket keres! Hely. Stuttgart Elvarasok: Nemet nyelvtudas Szakmai vegzettseg mint asztalos/ ablakbeepitö üvegezesi szakmai tapasztalattal, vagy Legalabb 5 eves szakmai tapasztalat mint üvegezö, ablakbeepitö. Ablak-vasalattipusok ismerete önallo munkavegzes B kat. jogositvany Berezes : megegyezes szerint Kezdes: azonnal Nemet nyelvü öneletrajzat, szakmai vegzettseget igazolo dokumentumait anita.antal@pracht-person varom
A hirdetés részletei >>

Feladva: 2016-06-27 13:55:41    

A Pracht GmbH. Üveges/ablakbeepitöket keres!Hely: Stuttgart Feladatok: ajtó, ablak javítás -üvegezés -termo-üvegezés -szigetelés üvegek meretre vagasa, csereje, javitasa,ajto, ablak, vasalatok beepitese, csereje, karbantartasa belsö ajto beepites, redönyszereles, nyilaszaro beepites, redönygurtni csere Elvarasok:nemet nyelvtudas,szakmai vegzettseg mint asztalos/ ablakbeepitö üvegezesi szakmai tapasztalattal Nemet öneletrajzat, szakmai dokumentumait anita.antal@pracht-person -re varo
A hirdetés részletei >>

Feladva: 2016-06-27 13:27:07    

Asztal 150 cm hossz x 74 széles. Pad 120 cm hossz ülőfelület, plusz hozzá való székek! A méretek és a székek, padok darabszáma megbeszélés alapján változtatható! Számla van.
A hirdetés részletei >>

Feladva: 2016-06-26 10:54:39    

Neobarok étkező garnitúra eladó! Tálaló, vitrin, asztal 6 db székkel
A hirdetés részletei >>

Feladva: 2016-06-24 10:17:39    

Rutinos számítógép szerelőt keres? Megtalálta. Számítógép szerviz Budapest egész területén házhoz megy. Amit vállalok: számítógép javítás, szerelés, karbantartás, amennyiben megoldható, bővítés, korszerűsítés. Nem csak asztali számítógépet, hanem laptopot is szervizelek. Ha meglévő gépét szeretné lecserélni, akkor a számítógép vásárlásban is megbízható partnere lehetek. Ne habozzon, tekintse meg weboldalamat a további részletekért és minél hamarabb kérjen ajánlatot.
A hirdetés részletei >>

Feladva: 2016-06-22 14:53:08    

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető . Az ágy teljes hossza:204,5cm, fekvő felület:194 cm
A hirdetés részletei >>

Feladva: 2016-06-22 07:44:01    

Címkék, kulcsszavak: antikhálószobarégiség

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető. Az ágy teljes hossza:204,5cm, fekvő felület:194 cm Az ágy fekvő szélessége:99cm
A hirdetés részletei >>

Feladva: 2016-06-19 17:15:03    

Címkék, kulcsszavak: antik bútorrégiséghálószoba bútorhagyaték

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető. Az ágy teljes hossza:204,5cm, fekvő felület:194 cm Az ágy fekvő szélessége:99cm
A hirdetés részletei >>

Feladva: 2016-06-19 17:09:33    

Címkék, kulcsszavak: antik bútorrégiséghálószoba bútorhagyaték

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető . Az ágy teljes hossza:204,5cm, fekvő felület:194 cm Az ágy
A hirdetés részletei >>

Feladva: 2016-06-19 09:49:06    

Címkék, kulcsszavak: Antikbútorhálószoba

Angliai munkára keresünk szakképzett, munkájára igényes, precíz bútorasztalost gyári munkára és helyszíni szerelésre. Bérezés kiemelkedő. Érdeklődni a m e-mail címen vagy a 00447841505257 telefonon. (Pintér Zoltan)
A hirdetés részletei >>

Feladva: 2016-06-17 12:02:18    

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető . Az ágy teljes hossza:204,5cm, fekvő felület:194 cm Az ágy
A hirdetés részletei >>

Feladva: 2016-06-14 11:33:51    

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető . Az ágy teljes hossza:204,5cm, fekvő felület:194 cm Az ágy
A hirdetés részletei >>

Feladva: 2016-06-14 11:07:52    

Címkék, kulcsszavak: antik bútorrégiséghálószoba bútorhagyaték

Pingpongasztal eladó, plusz 2 db tartalék asztallappal, vadonatújan, bontatlanul, 62.000 Ft-ért. Bármikor megnézhető, elvihető. Tel.: 06 70 4223842. E-mail:
A hirdetés részletei >>

Feladva: 2016-06-06 08:59:06    

Címkék, kulcsszavak: Asztali teniszPingpongasztal

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető.
A hirdetés részletei >>

Feladva: 2016-06-01 18:55:34    

Címkék, kulcsszavak: antik bútorrégiséghálószoba bútor

Megkímélt állapotban lévő ágyazható kanapé, ill. étkező asztal 6 székkel eladó.
A hirdetés részletei >>

Feladva: 2016-05-22 18:40:39    

ikea asztaL 62x62 és 72magas 7500FT CSEPEL 06203645194
A hirdetés részletei >>

Feladva: 2016-05-21 10:09:57    

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető a 0670--7763336-os telefonszámon Tel:06707763336
A hirdetés részletei >>

Feladva: 2016-05-12 10:09:22    

A Baranyai János Vasútbarát és Modellező Klub következő kiállítása 2016.julius 1-3. között /péntek,szombat,vasárnap/ lesz látható Veresegyházon a Mézesvölgyi Általános Iskola aulájában/Mogyoródi u. 5-7./ Nyitva reggel 9-13 óráig és 14 órától 18 óráig. Pénteken és vasárnap csak 17 óráig. Sok új látnivaló, érdekes asztalrészletek. Jöjjön el városunkba különböző programok, pl. szombaton főzőverseny, a színpadon a főtéren állandó műsorszámok. Bővebb tájékoztató a honlapunkon
A hirdetés részletei >>

Feladva: 2016-05-10 13:45:52    

A Baranyai János Vasútbarát és Modellező Klub következő kiállítása 2016.julius 1-3. között /péntek,szombat,vasárnap/ lesz látható Veresegyházon a Mézesvölgyi Általános Iskola aulájában/Mogyoródi u. 5-7./ Nyitva reggel 9-13 óráig és 14 órától 18 óráig. Pénteken és vasárnap csak 17 óráig. Sok új látnivaló, érdekes asztalrészletek. Jöjjön el városunkba különböző programok, pl. szombaton főzőverseny, a színpadon a főtéren állandó műsorszámok. Bővebb tájékoztató a honlapunkon
A hirdetés részletei >>

Feladva: 2016-05-10 13:35:08    

Címkék, kulcsszavak: terepasztalkiállításvasútmodell

A Baranyai János Vasútbarát és Modellező Klub következő kiállítása 2016.julius 1-3. között /péntek,szombat,vasárnap/ lesz látható Veresegyházon a Mézesvölgyi Általános Iskola aulájában/Mogyoródi u. 5-7./ Nyitva reggel 9-13 óráig és 14 órától 18 óráig. Pénteken és vasárnap csak 17 óráig. Sok új látnivaló, érdekes asztalrészletek. Jöjjön el városunkba különböző programok, pl. szombaton főzőverseny, a színpadon a főtéren állandó műsorszámok. Bővebb tájékoztató a honlapunkon
A hirdetés részletei >>

Feladva: 2016-05-10 13:29:34    

Címkék, kulcsszavak: terepasztalkiállításvasútmodell

Nemetorszagba keresünk festöket,gipszkartonosokat,asztalos okat hosszu tavra.Jelentkezni E-mailon:p
A hirdetés részletei >>

Feladva: 2016-05-08 09:20:54    

Nemetorszagba keresünk festöket,gipszkartonosokat,asztalos okat hosszu tavra.Jelentkezni E-mailon:p
A hirdetés részletei >>

Feladva: 2016-05-08 09:16:03    

Leírás: Antik, 10 elemből álló, megkímélt állapotú, faragásokkal gazdagon díszített garnitúra egyben eladó. Elemei: 2db kétajtós szekrény: 1 vállfás, 1 polcos 1db tükörállvány, (A fotón mögötte látható a két ágy fejrésze.) 2db ágy, A fotón helyhiány miatt nem a szabványos összeszerelésben látható. 2db éjjeliszekrény, 1db asztal, 2db szék, Hétvégén egész nap, munkanapokon 17 óra után vagyok elérhető a 0670--7763336-os telefonszámon Tel:06707763336
A hirdetés részletei >>

Feladva: 2016-05-07 15:04:05    

Szervizünk vállalja laptopok, asztali számítógépek, monitorok (TV-k) teljes körű javítását. GPS, Tablet készülékekben csatlakozó aljzat csere, nyomtatók tisztítása, javítása. Alaplap szinten javítjuk a készülékeket (BGA forrasztás), csatlakozók (DC, USB, jack, VGA, HDMI), billentyűzet, kijelző, burkolati elemek cseréje, készülékek bővítése, felújítása, karbantartása. Szoftveres karbantartás, vírusirtás, újra telepítés, beállítási problémák elhárítása.
A hirdetés részletei >>

Feladva: 2016-04-27 11:39:20    

Címkék, kulcsszavak: laptop javításnotebook javításmonitor javítástablet javítás

1db Szalagcsiszoló /260cm-es/ 1 db Asztali maró+koronák,és kések 1db Szöllődaráló 1 db 6személyes étkező asztal,Szék nélkül
A hirdetés részletei >>

Feladva: 2016-04-23 14:50:29    

Ugrálóvár több méretben 4-6-8 ezer Ft/nap ,sörsátor 3x6 méteres 4 ezer Ft /nap , gyerekeknek asztalok-székek 1000 Ft/garnitúra /nap ,sörpadok 1500 Ft/garnitúra /nap , buborékfújógép 3000 Ft/nap, bérelhetők.
A hirdetés részletei >>

Feladva: 2016-04-21 15:21:38    

Címkék, kulcsszavak: Ugrálóvár

Eladásra kínálom az alábbi, jó állapotban lévő asztali számítógépet. A gép azonnali használatra kész. Processzor: - Intel Celeron 3,6 GHz - nagy teljesítményű processzorhűtővel szerelve. Memória: - 2 db 1 GB DDR2 800 MHz Merevlemez (HDD): - Seagate 250 GB, Sata II., 3,5”-os - igény szerint további merevlemezek építhetőek be Optikai meghajtó: - LG DVD író: - igény szerint további optikai meghajtók építhetőek be Tápegység: - 400W-os Alaplap: Asrock 775i 945
A hirdetés részletei >>

Feladva: 2016-04-10 11:52:25    


tegnap, 2 napja, 3 napja, 4 napja, 5 napja, 6 napja


•   XBOX 360   •   pc bolt   •   fém   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360   •   hűtő   •   olcsó garancia   •   kiállitás   •   eps   •   vas eladó   •   Bál   •   eladó ház   •   kerék   •   UE 28   •   vasarlas   •   tart 1   •   füvesítés   •   ecomaxpoweredbyaltoc ms   •   1000poweredbyaltocms boldog   •   CAT   •   Bál1111111111111"   •   tart 11111111111111"   •   tart 11111111111111   •   költöztetés   •   about:blank   •   toll összeszerelés   •   német   •   Bál1111111111111   •   hitel   •   masszazs   •   tv   •   lcd   •   apolo   •   nyíregyháza   •   1.5   •   magánhitel   •   nyelv   •   Eladó   •   paypal   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3)))   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3))   •   PS3;XBOX360;PC;PS2;P S3;PSP;XBOX 360 And sLEEp(3)   •   xbox 360 && SLEEP(3) oRDeR BY 638 #   •   si cu   •   olcsó családi ház   •   szabads   •   kisebb   •   dealkodex   •   traktor xmlrpc php   •   bďż˝dogos esztergom   •   freedom  

TOP keresések

•   állás munka   •   ingatlan   •   honlap készítés   •   ingyen zene   •   ingyen játékok   •   olcsó weboldal   •   apróhirdetés   •   weboldal készítés   •   facebook   •   ingyen hirdetés   •   ingyen apróhirdetés   •   vacsoracsata   •   térkép   •   youtube   •   iwiw   •   magyarország   •   mobilbarát honlap   •   honlap olcsón   •   budapest   •   ingyen   •   szótár  

Most keresik

•   claude   •   ďż˝rizetben   •   ďż˝gyaszhatďż˝ ďż˝lďż˝garnitura   •   cibrabqspijsefuftjoh   •   OT C825   •   alig használt   •   tzzie11663 txt   •   eszkozt   •   struktúráját   •   sebek ke   •   Sebestyén   •   Snapdragon   •   bármikorra   •   kútfúrás hajdú bihar   •   ój   •   Ä?Â?TI   •   Hummelg   •   anionindexphpadminis tratorcomponentscust omeraccountvirtueopt ioncomjanews   •   lakatos Ferihegy   •   Plc   •   sz l stelep   •   Könyvelői szolgáltatás   •   Napelemes tanfolyam infrafűtés   •   pihenő idő   •   vin   •   aaaaaaaaacgaaaaaaaaa cs   •   könyv eladás vásárlás   •   nulla   •   Mogul   •   haszongďĹźË p   •   kďż˝pesek   •   börtönr l   •   7 le kistraktor   •   hďż˝nap   •   bejelentettmunkanyir   •   biztosítókra   •   alagutakban   •   dió2121121121212.1   •   palackozó   •   beton keverés   •   frissc4202020c42020c   •   Mostüzlet2010januárj   •   63740ll63740stkn6374 0 l   •   de befektetésreisalkalm as   •   LAPOSTETŐ SZIGETELŐ   •   balk   •   szoftverfejesztďż˝s   •   biztonságiajtózárcse   •   bi flux   •   részvét